ID: 1139080405

View in Genome Browser
Species Human (GRCh38)
Location 16:63511689-63511711
Sequence GGGAATGAAATGTTCATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139080405_1139080407 -6 Left 1139080405 16:63511689-63511711 CCTGCTATGAACATTTCATTCCC No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080405_1139080406 -7 Left 1139080405 16:63511689-63511711 CCTGCTATGAACATTTCATTCCC No data
Right 1139080406 16:63511705-63511727 CATTCCCAAGCCTTCTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139080405 Original CRISPR GGGAATGAAATGTTCATAGC AGG (reversed) Intergenic