ID: 1139080407

View in Genome Browser
Species Human (GRCh38)
Location 16:63511706-63511728
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139080402_1139080407 25 Left 1139080402 16:63511658-63511680 CCTATACCTGCATTTGAAGCTTC No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080405_1139080407 -6 Left 1139080405 16:63511689-63511711 CCTGCTATGAACATTTCATTCCC No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080401_1139080407 26 Left 1139080401 16:63511657-63511679 CCCTATACCTGCATTTGAAGCTT No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080403_1139080407 19 Left 1139080403 16:63511664-63511686 CCTGCATTTGAAGCTTCATCCAA No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080404_1139080407 0 Left 1139080404 16:63511683-63511705 CCAAAGCCTGCTATGAACATTTC No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139080407 Original CRISPR ATTCCCAAGCCTTCTCTTTC GGG Intergenic
No off target data available for this crispr