ID: 1139083404

View in Genome Browser
Species Human (GRCh38)
Location 16:63554308-63554330
Sequence CTGAGCCATGCAAAGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139083399_1139083404 10 Left 1139083399 16:63554275-63554297 CCTCTGCAAACAAAACCTGAGTA No data
Right 1139083404 16:63554308-63554330 CTGAGCCATGCAAAGGTCCAGGG No data
1139083401_1139083404 -5 Left 1139083401 16:63554290-63554312 CCTGAGTAAAATGAAGGACTGAG No data
Right 1139083404 16:63554308-63554330 CTGAGCCATGCAAAGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139083404 Original CRISPR CTGAGCCATGCAAAGGTCCA GGG Intergenic
No off target data available for this crispr