ID: 1139089106

View in Genome Browser
Species Human (GRCh38)
Location 16:63622114-63622136
Sequence ACTGAAGACATCCCTACATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139089104_1139089106 5 Left 1139089104 16:63622086-63622108 CCAGTGATAATAATGATGGTGGA No data
Right 1139089106 16:63622114-63622136 ACTGAAGACATCCCTACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139089106 Original CRISPR ACTGAAGACATCCCTACATA GGG Intergenic
No off target data available for this crispr