ID: 1139099175

View in Genome Browser
Species Human (GRCh38)
Location 16:63744564-63744586
Sequence GTGGCAGTGCTGGTGCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139099175_1139099182 4 Left 1139099175 16:63744564-63744586 CCGCCCTGCACCAGCACTGCCAC No data
Right 1139099182 16:63744591-63744613 GCAAATACACGCATGGAGGCTGG No data
1139099175_1139099180 -3 Left 1139099175 16:63744564-63744586 CCGCCCTGCACCAGCACTGCCAC No data
Right 1139099180 16:63744584-63744606 CACTAGTGCAAATACACGCATGG No data
1139099175_1139099181 0 Left 1139099175 16:63744564-63744586 CCGCCCTGCACCAGCACTGCCAC No data
Right 1139099181 16:63744587-63744609 TAGTGCAAATACACGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139099175 Original CRISPR GTGGCAGTGCTGGTGCAGGG CGG (reversed) Intergenic
No off target data available for this crispr