ID: 1139102900

View in Genome Browser
Species Human (GRCh38)
Location 16:63789611-63789633
Sequence GGGATGATCAATGCAAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139102896_1139102900 3 Left 1139102896 16:63789585-63789607 CCCACTTTCAAGTACATGTAAAC No data
Right 1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG No data
1139102897_1139102900 2 Left 1139102897 16:63789586-63789608 CCACTTTCAAGTACATGTAAACT No data
Right 1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139102900 Original CRISPR GGGATGATCAATGCAAATTG TGG Intergenic
No off target data available for this crispr