ID: 1139106493

View in Genome Browser
Species Human (GRCh38)
Location 16:63833015-63833037
Sequence CTGCACAAATAGAAAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139106493_1139106495 6 Left 1139106493 16:63833015-63833037 CCTGCTGCTTTCTATTTGTGCAG No data
Right 1139106495 16:63833044-63833066 ACAAACTGTTTCATATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139106493 Original CRISPR CTGCACAAATAGAAAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr