ID: 1139110688

View in Genome Browser
Species Human (GRCh38)
Location 16:63886995-63887017
Sequence GAGAAGCCAGTGGCTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139110688_1139110690 6 Left 1139110688 16:63886995-63887017 CCTGGTGGAGCCACTGGCTTCTC No data
Right 1139110690 16:63887024-63887046 CATCCACATTCCTCAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139110688 Original CRISPR GAGAAGCCAGTGGCTCCACC AGG (reversed) Intergenic
No off target data available for this crispr