ID: 1139111442

View in Genome Browser
Species Human (GRCh38)
Location 16:63896308-63896330
Sequence TATAAGCTTTACAAGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139111442_1139111447 -5 Left 1139111442 16:63896308-63896330 CCTTACCCCTTGTAAAGCTTATA No data
Right 1139111447 16:63896326-63896348 TTATAGTCTAGTTACAAACAGGG No data
1139111442_1139111446 -6 Left 1139111442 16:63896308-63896330 CCTTACCCCTTGTAAAGCTTATA No data
Right 1139111446 16:63896325-63896347 CTTATAGTCTAGTTACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139111442 Original CRISPR TATAAGCTTTACAAGGGGTA AGG (reversed) Intergenic
No off target data available for this crispr