ID: 1139112624

View in Genome Browser
Species Human (GRCh38)
Location 16:63909636-63909658
Sequence CTATAATCCTTATATGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139112624_1139112625 28 Left 1139112624 16:63909636-63909658 CCAATTTCATATAAGGATTATAG No data
Right 1139112625 16:63909687-63909709 ATACTACTTCCCAGAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139112624 Original CRISPR CTATAATCCTTATATGAAAT TGG (reversed) Intergenic
No off target data available for this crispr