ID: 1139116727

View in Genome Browser
Species Human (GRCh38)
Location 16:63963332-63963354
Sequence TGCCCAACCAGACTGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139116727_1139116731 16 Left 1139116727 16:63963332-63963354 CCCACTCTCAGTCTGGTTGGGCA No data
Right 1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG No data
1139116727_1139116732 20 Left 1139116727 16:63963332-63963354 CCCACTCTCAGTCTGGTTGGGCA No data
Right 1139116732 16:63963375-63963397 GCAGCCAGAATAAAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139116727 Original CRISPR TGCCCAACCAGACTGAGAGT GGG (reversed) Intergenic
No off target data available for this crispr