ID: 1139116729

View in Genome Browser
Species Human (GRCh38)
Location 16:63963355-63963377
Sequence TGCACTGGCAGCTGATTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2517
Summary {0: 108, 1: 196, 2: 538, 3: 750, 4: 925}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139116729_1139116731 -7 Left 1139116729 16:63963355-63963377 CCATCTAATCAGCTGCCAGTGCA 0: 108
1: 196
2: 538
3: 750
4: 925
Right 1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG No data
1139116729_1139116732 -3 Left 1139116729 16:63963355-63963377 CCATCTAATCAGCTGCCAGTGCA 0: 108
1: 196
2: 538
3: 750
4: 925
Right 1139116732 16:63963375-63963397 GCAGCCAGAATAAAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139116729 Original CRISPR TGCACTGGCAGCTGATTAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr