ID: 1139116731

View in Genome Browser
Species Human (GRCh38)
Location 16:63963371-63963393
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139116729_1139116731 -7 Left 1139116729 16:63963355-63963377 CCATCTAATCAGCTGCCAGTGCA 0: 108
1: 196
2: 538
3: 750
4: 925
Right 1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG No data
1139116728_1139116731 15 Left 1139116728 16:63963333-63963355 CCACTCTCAGTCTGGTTGGGCAC No data
Right 1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG No data
1139116727_1139116731 16 Left 1139116727 16:63963332-63963354 CCCACTCTCAGTCTGGTTGGGCA No data
Right 1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139116731 Original CRISPR CAGTGCAGCCAGAATAAAGC AGG Intergenic
No off target data available for this crispr