ID: 1139120350

View in Genome Browser
Species Human (GRCh38)
Location 16:64009017-64009039
Sequence TTCGTTATTTACACTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139120349_1139120350 -3 Left 1139120349 16:64008997-64009019 CCTATTTTTAATCAATGGTATTC No data
Right 1139120350 16:64009017-64009039 TTCGTTATTTACACTGTGCCAGG No data
1139120348_1139120350 -2 Left 1139120348 16:64008996-64009018 CCCTATTTTTAATCAATGGTATT No data
Right 1139120350 16:64009017-64009039 TTCGTTATTTACACTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139120350 Original CRISPR TTCGTTATTTACACTGTGCC AGG Intergenic
No off target data available for this crispr