ID: 1139124386

View in Genome Browser
Species Human (GRCh38)
Location 16:64060150-64060172
Sequence GCCTGATTCTAGGCCTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139124386_1139124388 -9 Left 1139124386 16:64060150-64060172 CCTGCATAGGCCTAGAATCAGGC No data
Right 1139124388 16:64060164-64060186 GAATCAGGCATTTCTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139124386 Original CRISPR GCCTGATTCTAGGCCTATGC AGG (reversed) Intergenic
No off target data available for this crispr