ID: 1139127467

View in Genome Browser
Species Human (GRCh38)
Location 16:64096581-64096603
Sequence CTTTCAACACAAATCTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139127461_1139127467 27 Left 1139127461 16:64096531-64096553 CCAGAGATCTTGATTTTCATGGG No data
Right 1139127467 16:64096581-64096603 CTTTCAACACAAATCTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139127467 Original CRISPR CTTTCAACACAAATCTAATA AGG Intergenic
No off target data available for this crispr