ID: 1139144813

View in Genome Browser
Species Human (GRCh38)
Location 16:64310394-64310416
Sequence TTCAAGGTATAGAGCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139144810_1139144813 -6 Left 1139144810 16:64310377-64310399 CCTTGTGCATGACTTTGTTCAAG No data
Right 1139144813 16:64310394-64310416 TTCAAGGTATAGAGCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139144813 Original CRISPR TTCAAGGTATAGAGCTTTGG AGG Intergenic
No off target data available for this crispr