ID: 1139146262

View in Genome Browser
Species Human (GRCh38)
Location 16:64328985-64329007
Sequence GGTTATGTCCATTGACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139146262_1139146267 4 Left 1139146262 16:64328985-64329007 CCCTTAGGTCAATGGACATAACC No data
Right 1139146267 16:64329012-64329034 AAGTGAGATTGCAGCTCAGTAGG No data
1139146262_1139146268 7 Left 1139146262 16:64328985-64329007 CCCTTAGGTCAATGGACATAACC No data
Right 1139146268 16:64329015-64329037 TGAGATTGCAGCTCAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139146262 Original CRISPR GGTTATGTCCATTGACCTAA GGG (reversed) Intergenic
No off target data available for this crispr