ID: 1139154570

View in Genome Browser
Species Human (GRCh38)
Location 16:64424920-64424942
Sequence CAATTGTACCAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139154570_1139154574 18 Left 1139154570 16:64424920-64424942 CCCTCTTCCTTCTGGTACAATTG No data
Right 1139154574 16:64424961-64424983 ACTGAGCATCTTCCCCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139154570 Original CRISPR CAATTGTACCAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr