ID: 1139156904

View in Genome Browser
Species Human (GRCh38)
Location 16:64454506-64454528
Sequence GTTGTAATGGGAGCATGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139156904_1139156908 11 Left 1139156904 16:64454506-64454528 CCTTATCATGCTCCCATTACAAC No data
Right 1139156908 16:64454540-64454562 TGAAGCCTACAAATTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139156904 Original CRISPR GTTGTAATGGGAGCATGATA AGG (reversed) Intergenic
No off target data available for this crispr