ID: 1139159602

View in Genome Browser
Species Human (GRCh38)
Location 16:64488503-64488525
Sequence CTATTACAGAACCCTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139159602_1139159604 16 Left 1139159602 16:64488503-64488525 CCAATAAAAGGGTTCTGTAATAG No data
Right 1139159604 16:64488542-64488564 ATATATTGTGCCATCTCAGAAGG No data
1139159602_1139159605 20 Left 1139159602 16:64488503-64488525 CCAATAAAAGGGTTCTGTAATAG No data
Right 1139159605 16:64488546-64488568 ATTGTGCCATCTCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139159602 Original CRISPR CTATTACAGAACCCTTTTAT TGG (reversed) Intergenic
No off target data available for this crispr