ID: 1139166460

View in Genome Browser
Species Human (GRCh38)
Location 16:64571182-64571204
Sequence CTGTGTGAGAAGCAGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139166458_1139166460 -6 Left 1139166458 16:64571165-64571187 CCATTACCTAGAGTTGGCTGTGT No data
Right 1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG No data
1139166453_1139166460 17 Left 1139166453 16:64571142-64571164 CCGATAGCTGTTCACCCTGGAAC No data
Right 1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG No data
1139166457_1139166460 -5 Left 1139166457 16:64571164-64571186 CCCATTACCTAGAGTTGGCTGTG No data
Right 1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG No data
1139166454_1139166460 3 Left 1139166454 16:64571156-64571178 CCCTGGAACCCATTACCTAGAGT No data
Right 1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG No data
1139166455_1139166460 2 Left 1139166455 16:64571157-64571179 CCTGGAACCCATTACCTAGAGTT No data
Right 1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139166460 Original CRISPR CTGTGTGAGAAGCAGCTGAA TGG Intergenic
No off target data available for this crispr