ID: 1139170778

View in Genome Browser
Species Human (GRCh38)
Location 16:64627483-64627505
Sequence CCTGATTTACTAGCAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139170769_1139170778 17 Left 1139170769 16:64627443-64627465 CCACTGAGACAAAAACTGCCAGC No data
Right 1139170778 16:64627483-64627505 CCTGATTTACTAGCAAAGCAGGG No data
1139170768_1139170778 30 Left 1139170768 16:64627430-64627452 CCACAAGGCTTCTCCACTGAGAC No data
Right 1139170778 16:64627483-64627505 CCTGATTTACTAGCAAAGCAGGG No data
1139170771_1139170778 -1 Left 1139170771 16:64627461-64627483 CCAGCTTTCAGGCCACACCCCTC No data
Right 1139170778 16:64627483-64627505 CCTGATTTACTAGCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139170778 Original CRISPR CCTGATTTACTAGCAAAGCA GGG Intergenic
No off target data available for this crispr