ID: 1139171167

View in Genome Browser
Species Human (GRCh38)
Location 16:64631226-64631248
Sequence CTGAAGCCTGAGATTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139171167_1139171168 -2 Left 1139171167 16:64631226-64631248 CCATTTCAAATCTCAGGCTTCAG No data
Right 1139171168 16:64631247-64631269 AGTCTCCTCATCCAGAAGACTGG No data
1139171167_1139171169 1 Left 1139171167 16:64631226-64631248 CCATTTCAAATCTCAGGCTTCAG No data
Right 1139171169 16:64631250-64631272 CTCCTCATCCAGAAGACTGGTGG No data
1139171167_1139171174 14 Left 1139171167 16:64631226-64631248 CCATTTCAAATCTCAGGCTTCAG No data
Right 1139171174 16:64631263-64631285 AGACTGGTGGGGAATTGAAGAGG No data
1139171167_1139171170 2 Left 1139171167 16:64631226-64631248 CCATTTCAAATCTCAGGCTTCAG No data
Right 1139171170 16:64631251-64631273 TCCTCATCCAGAAGACTGGTGGG No data
1139171167_1139171172 3 Left 1139171167 16:64631226-64631248 CCATTTCAAATCTCAGGCTTCAG No data
Right 1139171172 16:64631252-64631274 CCTCATCCAGAAGACTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139171167 Original CRISPR CTGAAGCCTGAGATTTGAAA TGG (reversed) Intergenic
No off target data available for this crispr