ID: 1139173388

View in Genome Browser
Species Human (GRCh38)
Location 16:64658569-64658591
Sequence CTGTTTCTTACTTGGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139173388_1139173396 23 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173396 16:64658615-64658637 ACAAAGGCAATTTAGATGAAGGG No data
1139173388_1139173392 -2 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173392 16:64658590-64658612 AGAAAGACATCAGGCATGGCAGG No data
1139173388_1139173393 -1 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173393 16:64658591-64658613 GAAAGACATCAGGCATGGCAGGG No data
1139173388_1139173395 22 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173395 16:64658614-64658636 AACAAAGGCAATTTAGATGAAGG No data
1139173388_1139173391 -6 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173391 16:64658586-64658608 AAACAGAAAGACATCAGGCATGG No data
1139173388_1139173394 7 Left 1139173388 16:64658569-64658591 CCATCAGTCCAAGTAAGAAACAG No data
Right 1139173394 16:64658599-64658621 TCAGGCATGGCAGGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139173388 Original CRISPR CTGTTTCTTACTTGGACTGA TGG (reversed) Intergenic
No off target data available for this crispr