ID: 1139173635

View in Genome Browser
Species Human (GRCh38)
Location 16:64662047-64662069
Sequence ATGAACAATATTAGAACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139173631_1139173635 30 Left 1139173631 16:64661994-64662016 CCTCTGGGAGAAGACATTTTTAG No data
Right 1139173635 16:64662047-64662069 ATGAACAATATTAGAACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139173635 Original CRISPR ATGAACAATATTAGAACTAT AGG Intergenic
No off target data available for this crispr