ID: 1139174872

View in Genome Browser
Species Human (GRCh38)
Location 16:64674789-64674811
Sequence CTTTTTAGGGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139174872_1139174883 23 Left 1139174872 16:64674789-64674811 CCCTCCAGCCTCACCCTAAAAAG No data
Right 1139174883 16:64674835-64674857 AACTGAAAGACCAAGAAATATGG No data
1139174872_1139174884 24 Left 1139174872 16:64674789-64674811 CCCTCCAGCCTCACCCTAAAAAG No data
Right 1139174884 16:64674836-64674858 ACTGAAAGACCAAGAAATATGGG No data
1139174872_1139174885 25 Left 1139174872 16:64674789-64674811 CCCTCCAGCCTCACCCTAAAAAG No data
Right 1139174885 16:64674837-64674859 CTGAAAGACCAAGAAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139174872 Original CRISPR CTTTTTAGGGTGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr