ID: 1139177669

View in Genome Browser
Species Human (GRCh38)
Location 16:64709203-64709225
Sequence GCTGCTAGAATGCCAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139177668_1139177669 -5 Left 1139177668 16:64709185-64709207 CCTATTCTAACTAATTCAGCTGC No data
Right 1139177669 16:64709203-64709225 GCTGCTAGAATGCCAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139177669 Original CRISPR GCTGCTAGAATGCCAATAGC TGG Intergenic
No off target data available for this crispr