ID: 1139180729

View in Genome Browser
Species Human (GRCh38)
Location 16:64745310-64745332
Sequence TTTTCAAATAGGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139180729_1139180736 29 Left 1139180729 16:64745310-64745332 CCCTCCATCTTCCTATTTGAAAA No data
Right 1139180736 16:64745362-64745384 ACTCCAAACGTCCAGTCTGATGG No data
1139180729_1139180734 -4 Left 1139180729 16:64745310-64745332 CCCTCCATCTTCCTATTTGAAAA No data
Right 1139180734 16:64745329-64745351 AAAATTCCAGGAGACAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139180729 Original CRISPR TTTTCAAATAGGAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr