ID: 1139182582

View in Genome Browser
Species Human (GRCh38)
Location 16:64765523-64765545
Sequence TAGGCCCTGCCAATAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139182575_1139182582 16 Left 1139182575 16:64765484-64765506 CCCAAGATGAGCATTATTACTCG No data
Right 1139182582 16:64765523-64765545 TAGGCCCTGCCAATAACCCCTGG No data
1139182574_1139182582 17 Left 1139182574 16:64765483-64765505 CCCCAAGATGAGCATTATTACTC No data
Right 1139182582 16:64765523-64765545 TAGGCCCTGCCAATAACCCCTGG No data
1139182576_1139182582 15 Left 1139182576 16:64765485-64765507 CCAAGATGAGCATTATTACTCGG No data
Right 1139182582 16:64765523-64765545 TAGGCCCTGCCAATAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139182582 Original CRISPR TAGGCCCTGCCAATAACCCC TGG Intergenic
No off target data available for this crispr