ID: 1139184694

View in Genome Browser
Species Human (GRCh38)
Location 16:64791869-64791891
Sequence TCAATTCCATAGTGTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139184687_1139184694 16 Left 1139184687 16:64791830-64791852 CCCTGCCTTGGCCATACCTCATT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184685_1139184694 23 Left 1139184685 16:64791823-64791845 CCCAAGTCCCTGCCTTGGCCATA No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184690_1139184694 5 Left 1139184690 16:64791841-64791863 CCATACCTCATTTAGCTTTCCCT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184688_1139184694 15 Left 1139184688 16:64791831-64791853 CCTGCCTTGGCCATACCTCATTT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184684_1139184694 24 Left 1139184684 16:64791822-64791844 CCCCAAGTCCCTGCCTTGGCCAT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184689_1139184694 11 Left 1139184689 16:64791835-64791857 CCTTGGCCATACCTCATTTAGCT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184691_1139184694 0 Left 1139184691 16:64791846-64791868 CCTCATTTAGCTTTCCCTTATTT No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data
1139184686_1139184694 22 Left 1139184686 16:64791824-64791846 CCAAGTCCCTGCCTTGGCCATAC No data
Right 1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139184694 Original CRISPR TCAATTCCATAGTGTTTCCC TGG Intergenic
No off target data available for this crispr