ID: 1139193113

View in Genome Browser
Species Human (GRCh38)
Location 16:64887746-64887768
Sequence TAGTAACTACAACATAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139193113_1139193115 0 Left 1139193113 16:64887746-64887768 CCATGCTTATGTTGTAGTTACTA No data
Right 1139193115 16:64887769-64887791 TCATCCCTATTTTACAGACAGGG No data
1139193113_1139193114 -1 Left 1139193113 16:64887746-64887768 CCATGCTTATGTTGTAGTTACTA No data
Right 1139193114 16:64887768-64887790 ATCATCCCTATTTTACAGACAGG No data
1139193113_1139193118 8 Left 1139193113 16:64887746-64887768 CCATGCTTATGTTGTAGTTACTA No data
Right 1139193118 16:64887777-64887799 ATTTTACAGACAGGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139193113 Original CRISPR TAGTAACTACAACATAAGCA TGG (reversed) Intergenic
No off target data available for this crispr