ID: 1139193113 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:64887746-64887768 |
| Sequence | TAGTAACTACAACATAAGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139193113_1139193115 | 0 | Left | 1139193113 | 16:64887746-64887768 | CCATGCTTATGTTGTAGTTACTA | No data | ||
| Right | 1139193115 | 16:64887769-64887791 | TCATCCCTATTTTACAGACAGGG | No data | ||||
| 1139193113_1139193114 | -1 | Left | 1139193113 | 16:64887746-64887768 | CCATGCTTATGTTGTAGTTACTA | No data | ||
| Right | 1139193114 | 16:64887768-64887790 | ATCATCCCTATTTTACAGACAGG | No data | ||||
| 1139193113_1139193118 | 8 | Left | 1139193113 | 16:64887746-64887768 | CCATGCTTATGTTGTAGTTACTA | No data | ||
| Right | 1139193118 | 16:64887777-64887799 | ATTTTACAGACAGGGAATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139193113 | Original CRISPR | TAGTAACTACAACATAAGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||