ID: 1139198120

View in Genome Browser
Species Human (GRCh38)
Location 16:64944697-64944719
Sequence CTGGGTTTCTGGGGGTGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139198120 Original CRISPR CTGGGTTTCTGGGGGTGACA GGG (reversed) Exonic
900208402 1:1441270-1441292 TTGGGTTTCTGGTGGGGCCACGG - Exonic
900514953 1:3077265-3077287 CTGGGTTTCTGGGGCTGATGTGG - Intronic
900976255 1:6018432-6018454 GTGGGGCTCTGGGGGTGATAAGG + Intronic
901005619 1:6170359-6170381 CTGGGTCTCTGGGGCTCCCATGG + Intronic
901398617 1:9000801-9000823 CTGGATTCCTGGGGGTGATGGGG - Intergenic
902751080 1:18511608-18511630 ATGAATCTCTGGGGGTGACAGGG - Intergenic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903795729 1:25927598-25927620 CTCAGTTTCTGGGGGAGAAAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904031585 1:27536710-27536732 TTGGGGTGTTGGGGGTGACAAGG + Intronic
905037200 1:34925911-34925933 CTGGGTTTGTGGGGGTGTCCAGG - Intronic
905233967 1:36532950-36532972 CTGGGTGTGTGGGGGTGGAAAGG - Intergenic
905242463 1:36589729-36589751 GTGGGCTTGTGGGGGAGACATGG + Intergenic
905251839 1:36654293-36654315 CTGGGATGCAGGGGGTCACAGGG - Intergenic
905307046 1:37027068-37027090 ATGGTTTTCTGGGGGTGAGTCGG - Intronic
905484020 1:38283094-38283116 GGAAGTTTCTGGGGGTGACAAGG + Intergenic
906076419 1:43055427-43055449 CTGGTCTTCTAGGGTTGACAAGG + Intergenic
906322795 1:44827302-44827324 CTGGATTCCTGGGGGAGACCAGG + Exonic
907282782 1:53361912-53361934 CTGGGTTCTAGGGGGTGACTGGG + Intergenic
911423160 1:97671760-97671782 CTGTGTTTGTGTGGGTGACAGGG + Intronic
913393317 1:118338789-118338811 CAGGGCTTCTGATGGTGACAAGG - Intergenic
914245332 1:145881566-145881588 CTGCTTTCCTGGGGGTGACCTGG - Intronic
914263934 1:146021674-146021696 CTGGGGACCTGGGGGAGACACGG - Exonic
914988783 1:152480740-152480762 CTGTCTCACTGGGGGTGACAGGG + Intergenic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915669066 1:157472200-157472222 CTGTGTGTCTGGGAGTGACGTGG - Intergenic
916243476 1:162662926-162662948 TTGGGTGTGTGGGGTTGACACGG + Intronic
917720197 1:177779792-177779814 ATGGGTGTCCGGGGGTGAGAGGG - Intergenic
917741414 1:177964941-177964963 ATGGGCTTCTGGAGGTGAGATGG + Intronic
921223261 1:212990105-212990127 CAAGATTTCTGGGGGTGACAGGG + Exonic
922336063 1:224618723-224618745 TTAGGAATCTGGGGGTGACAGGG + Intronic
922510314 1:226160679-226160701 CTGAGTTTGTAGGGGTGGCATGG - Intronic
922886629 1:229025347-229025369 CTGGTCCTCTGGGGGTGACAGGG + Intergenic
923856032 1:237846652-237846674 CTGGGAGTCTGGGGATGCCAAGG + Intergenic
923911786 1:238455668-238455690 CTGGTTTCCTTGGGGTCACATGG - Intergenic
924568184 1:245215190-245215212 CTGGGTTTCTGGGTGCCAGATGG + Intronic
924606733 1:245541868-245541890 CTGGGTTTCTGGGCCTCAGAAGG + Intronic
924638377 1:245810047-245810069 ATTGGTTTCTGGTGGTGAAATGG - Intronic
924650233 1:245919302-245919324 CTGGGGTTCAGGGAGAGACATGG - Intronic
1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG + Intronic
1062862655 10:822536-822558 GTGGGCTTCTGGGTCTGACACGG - Intronic
1064491233 10:15859907-15859929 CTGGGTTGCAGGGCGTGACACGG - Intronic
1069245571 10:66200983-66201005 CTGAGTTTCAGGGTGTCACATGG - Intronic
1070307386 10:75247848-75247870 CTGATTTCCTGGGGGTGAGAAGG + Intergenic
1070499969 10:77063352-77063374 CTGGGTTGCTGGGGGAGAGGTGG + Intronic
1072143348 10:92610305-92610327 CTGGCTTTCATGGGGTGAAAGGG + Intronic
1072717037 10:97759227-97759249 CTGGGCTTCAGGGGCTGAAAAGG - Exonic
1072747190 10:97949068-97949090 CTAGCTTTCTGGGTGTGATATGG - Intronic
1074986491 10:118664379-118664401 CTGGGGTTCTGGGGGTAGGATGG + Intergenic
1075471886 10:122697260-122697282 CTGGGTCCATGGGGGTGACTGGG - Intergenic
1075666769 10:124236577-124236599 CAGGGTCTCTGGGGTTGCCATGG - Intergenic
1077422836 11:2460984-2461006 CTGGGTTTCCGGGGGTGTCCGGG + Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1081973374 11:47215144-47215166 CTGGGTTTCTGGGCGTTTCTTGG - Exonic
1081992853 11:47346990-47347012 CTGGGTGTTTGGGGGCGGCAGGG - Intronic
1083228781 11:61301808-61301830 CTTGGATTCTGGGGGTCCCAGGG + Intronic
1083827116 11:65210175-65210197 CTGGGGTGCTAGTGGTGACATGG + Intronic
1083902785 11:65651738-65651760 CTGGGTTCCTGGGTGTGCCTTGG - Intergenic
1085497093 11:76979644-76979666 CTTTTTTTCTGGGGGGGACAGGG - Intronic
1088630955 11:111773511-111773533 CTGGGATTATGGGCGTCACAAGG + Intergenic
1088904218 11:114142080-114142102 TTGGGCTTCTGGAGGTGACTTGG + Intronic
1089634790 11:119805158-119805180 CTGGGTTTCTGGGGGCCCCAAGG + Intergenic
1090387045 11:126363398-126363420 CTGGGACTCTGGGGGTGGCTGGG + Intronic
1098129388 12:67333041-67333063 ATGGGTGTCTGGGAGTGAAAAGG - Intergenic
1100694905 12:97082063-97082085 GTGATTTTTTGGGGGTGACAGGG + Intergenic
1101898785 12:108775705-108775727 CTGAGTGTCTGAGGGTGGCAAGG - Intergenic
1102251641 12:111391385-111391407 CTGGGTTTCTGGGCGGGAGTTGG - Intergenic
1102506895 12:113389405-113389427 CTGTGCTTCTTGGGGTGGCAGGG + Exonic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1106788181 13:33128367-33128389 CTGGGTTTCTGGTTGAGGCAAGG - Intronic
1110352539 13:74526041-74526063 CTGGATTTTTGGGGGTGAGGAGG + Intergenic
1112458159 13:99580397-99580419 AGGGGTTTCTGGGTGTGATAGGG + Intergenic
1115879532 14:37899537-37899559 CTGGGAGTCTGGGGCTGACATGG - Intronic
1120292589 14:82594308-82594330 CTTTGTTTCTGGGAGTGAGAGGG - Intergenic
1120853696 14:89194548-89194570 CAGGGTGTCAGGGTGTGACAAGG - Intronic
1121021645 14:90583969-90583991 CTGGGTTTCTGGGGGGTCCTGGG - Intronic
1121718919 14:96095813-96095835 ATGGGTTTCTAGGGCTGAGATGG + Intergenic
1121734001 14:96205446-96205468 CTGGCTCCCTGGGGGTGGCAGGG + Intronic
1121938504 14:98044228-98044250 CTTGGATACTGGGGGTGAGATGG + Intergenic
1122378231 14:101283102-101283124 CTGGGGTTCAGGGGTTGAGAAGG + Intergenic
1127188016 15:56500393-56500415 TTGGGTTTCTCCGGGGGACAAGG - Intergenic
1127603786 15:60565672-60565694 CTGGTTCTCTGAGGGTGATATGG - Intronic
1128787463 15:70408613-70408635 CTGGAGTTCTGAGGGTGAAAAGG + Intergenic
1129228962 15:74185953-74185975 TTGAGATTCTGGTGGTGACACGG - Intronic
1129263773 15:74383241-74383263 CAGGGCTGATGGGGGTGACACGG - Intergenic
1131362152 15:91802652-91802674 CTCAGATTTTGGGGGTGACATGG + Intergenic
1131918972 15:97302124-97302146 CTGGGTTTCTGTGCTTTACAGGG + Intergenic
1132077541 15:98834925-98834947 CTGGGTGTCTGGGCGTGCCCTGG - Intronic
1132386385 15:101403646-101403668 CTGAGAAGCTGGGGGTGACAGGG - Intronic
1132505099 16:304086-304108 CTGGGCCTCTGAGGGTGGCATGG + Intronic
1132517465 16:372466-372488 CTGGGCCTCTGTGGGTGCCATGG + Intronic
1132553826 16:564233-564255 CTGGGTCCCTGGGGGTGACTCGG - Exonic
1132592234 16:731074-731096 CTGGGCTTCAGGGGATGACCGGG + Intronic
1132665563 16:1079989-1080011 CTCCGCTCCTGGGGGTGACACGG - Exonic
1132845825 16:2000390-2000412 CAGGGTGTGTGGGGGTGCCAGGG - Exonic
1133020791 16:2966125-2966147 CTGGGTTACTGCGGGTGGGAGGG - Exonic
1133035490 16:3031643-3031665 CTGGGCATCTGGGTGTGCCAGGG - Intronic
1133146740 16:3792883-3792905 CTGGGTGACTGGCAGTGACATGG - Intronic
1136244925 16:28969499-28969521 CTGAGTTGGAGGGGGTGACAGGG - Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137747777 16:50835636-50835658 ATGGGTTGCTGGGGGTGCCCAGG + Intergenic
1138204463 16:55114671-55114693 CTGGGTTGGTGGGTGGGACATGG + Intergenic
1138960715 16:62025478-62025500 AGGGGTTTCTAGGGGTGAGATGG + Intronic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1141717012 16:85732743-85732765 CTGGGTCTCTGGAGGTGATGAGG - Intronic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1142352834 16:89587722-89587744 CCGTGTATCTGTGGGTGACACGG - Intronic
1142352850 16:89587785-89587807 CCGTGTATCTGTGGGTGACACGG - Intronic
1142352901 16:89587977-89587999 CCGTGTATCTGTGGGTGACACGG - Intronic
1142352934 16:89588095-89588117 CCGTGTATCTGTGGGTGACACGG - Intronic
1142551984 17:746514-746536 CTGCGTTCCTGGGGGCGAAAGGG - Exonic
1143735988 17:8912279-8912301 CTGGGTCTCTGGGGAAGCCACGG + Intronic
1143830609 17:9647590-9647612 CTAGGTTTCTGCAGGTGAGAAGG - Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147708033 17:42441552-42441574 CTGGGGTGTTGGGGGTGGCAGGG - Intergenic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148806583 17:50266972-50266994 CTGGGTTGCTGAGTGGGACAGGG - Intergenic
1150873665 17:68944492-68944514 CTTGTTTTGTGGGGCTGACAGGG - Intronic
1152025159 17:77804197-77804219 CTGAGTTTTTTGGGGTGAGATGG - Intergenic
1152379900 17:79937057-79937079 GGGGGTTGCTGGGGGTGCCAAGG - Exonic
1152528400 17:80902719-80902741 ATGGGTGTCTGGGGGTGAGGAGG - Intronic
1153468528 18:5416328-5416350 ATGGGTGGATGGGGGTGACAAGG + Exonic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1155062695 18:22242627-22242649 CTGGGAATCTGGGGGTGGCTCGG + Intergenic
1156112118 18:33740713-33740735 CTGGGTTTATGGGGATTTCAAGG + Intronic
1156613433 18:38753814-38753836 CTGTGTTTCTGAGGGGAACATGG + Intergenic
1158887361 18:61840817-61840839 CTAGGTTTGTGGAAGTGACAAGG + Intronic
1160224730 18:77003772-77003794 CAAGGTTTCTGGGGATGTCAAGG - Intronic
1160373077 18:78390557-78390579 CTGCGGGCCTGGGGGTGACATGG + Intergenic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1160875258 19:1293848-1293870 CTGGGTCTCCAGGGGTGAGAAGG - Intronic
1161297589 19:3527530-3527552 CTGGGCTCCTGGGGCTGGCAGGG + Intronic
1161482896 19:4519563-4519585 CTGTGTTATTGGGGGTGAGAGGG + Intergenic
1161639449 19:5411850-5411872 CTGTGTTTTTGGTGGAGACAGGG - Intergenic
1161912939 19:7208051-7208073 GTGGTTTTCTGGGGGGTACAAGG - Intronic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163034006 19:14561282-14561304 CTGGGTTTCTGTGGGTAGGAAGG + Intronic
1163490530 19:17614876-17614898 CTGGGGTGCCGGGGGTGCCAGGG + Intronic
1163638870 19:18450489-18450511 CTGGGGCTCCGGGGGTGGCATGG + Exonic
1165209593 19:34223354-34223376 CTGGGTTTATAGGTGTGCCATGG + Intronic
1165680851 19:37773894-37773916 CTGGGTTTCCTGGGGTGTGAGGG - Intronic
1165814759 19:38634978-38635000 CTGGCTGTCTGCAGGTGACAGGG - Exonic
1166071365 19:40390055-40390077 CTGGGGGTTTGGGGGTGCCAGGG - Exonic
1166083539 19:40459956-40459978 CTGAGGTTCTGAGGGGGACATGG + Intronic
1166415074 19:42589333-42589355 CTGGGTTTCTAGGGGTGGGTGGG + Intronic
1167446955 19:49543374-49543396 CTGGGGTTGGGGGTGTGACAGGG - Exonic
1167456949 19:49601476-49601498 CGGGGGCTCTGGGGGAGACAGGG - Exonic
1167490826 19:49792077-49792099 CTGGGTATCCGGGGGTGTGAGGG - Intronic
1167490856 19:49792151-49792173 CTGGGTATCCGGGGGTGTGAGGG - Intronic
1167701864 19:51053310-51053332 CTGGGTTACTGGTGGAGACAAGG - Intergenic
925094135 2:1181499-1181521 CTGGGTTTCTTGTGATTACAAGG - Intronic
925732451 2:6928952-6928974 TTGGCATTTTGGGGGTGACATGG + Intronic
926367154 2:12143959-12143981 CAGGGTTTATGGGGGGCACAGGG + Intergenic
927508843 2:23631771-23631793 CTAGGTTTCAGGGGGTCAGAAGG - Intronic
928683097 2:33722791-33722813 CTGTGTTTTTGGGAGTGAAAAGG + Intergenic
929268031 2:39940525-39940547 CTGGAATTCTGGGGCTGAGATGG + Intergenic
932343324 2:70979952-70979974 AGGGGTTGCTGGAGGTGACAAGG + Intronic
933221687 2:79697057-79697079 CTGGTTTTCTCAGGGTCACATGG + Intronic
933598312 2:84304653-84304675 CCTGGCTTCTGGGGGAGACATGG + Intergenic
941430258 2:165406194-165406216 CTGTGTTGCTGTGGGTCACAGGG + Intergenic
943646560 2:190412704-190412726 CTGGCATTTTGGGGGTGAGAGGG + Intronic
943702908 2:191005833-191005855 CTGGGTGTCTGGGGATGTCAGGG - Intronic
946020422 2:216636426-216636448 CTGGCTTCCTGGGGATGGCAAGG + Intronic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
946395068 2:219439586-219439608 CTGGGTTTGGGGGAGTGGCAGGG + Intronic
946562049 2:220925090-220925112 CAGTGTTTCTGTGGGTGACCTGG + Intergenic
946750447 2:222890239-222890261 CTGGGCTTTTGGGGGTGGGAAGG + Intronic
947500307 2:230666629-230666651 CTGGGTTCCGGTGGGTGAAAGGG - Intergenic
948702649 2:239769929-239769951 CTGGGTCTCTTGGAGTGACATGG - Intronic
949031316 2:241798778-241798800 CTGGGGTTCGGGAGCTGACAGGG - Intronic
1169649150 20:7847594-7847616 CTGGATGTCTGGGGGTGAGGAGG - Intergenic
1169958306 20:11130656-11130678 AAGGGTTTCTGGGGCTGCCATGG - Intergenic
1172969422 20:38862623-38862645 CTGGGTTTCTCGGGATGATGAGG - Intronic
1172977515 20:38918142-38918164 CTGGGGTTCTGCGAGTGAGAAGG - Exonic
1174221692 20:48960672-48960694 CTGGGTTTCTGTTGTTGACCAGG + Intronic
1174392472 20:50226471-50226493 CAGGGCTGCTGGGGGTGGCAGGG + Intergenic
1175227088 20:57451016-57451038 CTGGGTTTCTAGGGTGGACCCGG + Intergenic
1176378019 21:6096435-6096457 CTGGGGTTGGGGGGTTGACAAGG - Intergenic
1179745454 21:43441811-43441833 CTGGGGTTGGGGGGTTGACAAGG + Intergenic
1179825932 21:43966504-43966526 CAGGGTTTGTGGGGGTACCAAGG - Intronic
1180054893 21:45352668-45352690 CTGGGTCTTTGGGAGGGACAGGG - Intergenic
1180698342 22:17768449-17768471 CTGGGCTTCTGGGTGGGGCATGG + Intronic
1181590974 22:23884473-23884495 CTGGGGTTCTCAGGATGACAGGG - Intronic
1181778237 22:25175191-25175213 CTGGGTTTCAAGGGTTGAAAAGG - Intronic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1181936245 22:26440899-26440921 CTGGATTTCTGGGGGTCCCCTGG + Intronic
1182108187 22:27704233-27704255 CTGGGTTTCTGGGTCTGAGGAGG - Intergenic
1183194735 22:36345573-36345595 GTGTGTCTGTGGGGGTGACATGG - Intronic
1183244725 22:36685152-36685174 CAGCGTTTCTGGGGGCGGCAGGG + Intronic
1183276161 22:36899625-36899647 CTGGGTTTCTGGCAGTGACTAGG + Intergenic
1184022156 22:41827996-41828018 CTAGCTTTCTTGGGGTGGCAGGG + Intergenic
1184071325 22:42149313-42149335 ATGGGTCTCTGGGCGTGACGTGG + Intergenic
1184148854 22:42627186-42627208 CTGAGATTCTGGGGATGACCGGG - Intronic
1184473460 22:44708514-44708536 CGGTGTTGCTGGGGGAGACACGG - Intronic
1184937459 22:47735576-47735598 CTGGGTCTCAGGGGATGAAAAGG + Intergenic
1185313193 22:50167965-50167987 ATGGTTATCTGGGGGTGACTGGG + Intergenic
1185313417 22:50169064-50169086 CTGGGTTATTTGGGGTGACTGGG + Intergenic
1185324733 22:50220106-50220128 CTGGGCTGCTGTGGGGGACATGG - Intronic
949945438 3:9186052-9186074 GTGGGTTTGAAGGGGTGACACGG - Intronic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
950795356 3:15506003-15506025 CTGGGTTCCTGGGAGTCCCATGG + Intronic
951810050 3:26688813-26688835 CAGGGATTATGGGGGTGAGATGG - Intronic
954043545 3:47909342-47909364 CTGGATTTCTGGTGTTGGCAAGG + Intronic
954154802 3:48679450-48679472 CTGGTGGTCTGGGGGGGACAAGG + Exonic
954998161 3:54900928-54900950 CTGAGTTACTGGGTGTGACAAGG + Intronic
955001232 3:54929543-54929565 CTGGGTTATGTGGGGTGACAAGG - Intronic
955496954 3:59543253-59543275 CAGGGTTTCTGGAGATCACAGGG - Intergenic
956576377 3:70757094-70757116 CTGGGTTGTTGGGGGACACAGGG - Intergenic
958571886 3:95894623-95894645 CTGGGTTTCTTGTTGAGACAGGG + Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
959626533 3:108458319-108458341 CTGGGTTTCTGGATGTGTCTAGG - Intronic
960992034 3:123318175-123318197 CTGGGTGTGTGGGATTGACAGGG - Intronic
961480372 3:127175661-127175683 ATGGGTTACTGGGGCAGACAGGG + Intergenic
961607490 3:128107555-128107577 CTGGGTTTCTGGGGTAGAGAAGG - Intronic
962056515 3:131877375-131877397 CTGGGCTCCTGGTGGTGATATGG + Intronic
963437567 3:145290053-145290075 CTGGGTTTCTGTGGCCTACAGGG + Intergenic
963447928 3:145439268-145439290 CTCTGTTGCTGGGGGTAACACGG - Intergenic
965305016 3:167053028-167053050 CTAGGTCACTGGGGTTGACATGG + Intergenic
967339337 3:188378940-188378962 TTGGATTCCTGGGGGTGAGAAGG + Intronic
967444034 3:189544026-189544048 CTGGGCTGCTTGCGGTGACATGG + Intergenic
968014665 3:195318928-195318950 CTAGGTTTCTGGGCCTGTCATGG - Intronic
968484475 4:852295-852317 CTTGGCTCCTGGGGGTGACGTGG - Intronic
968699494 4:2047840-2047862 CAGGGCTACTGGGGGTCACATGG + Intergenic
969291613 4:6243691-6243713 CAGGGGTACTGGGGGTGCCAAGG + Intergenic
969356370 4:6629008-6629030 CTGGATTTCTAGGTGTGGCATGG + Intergenic
969573458 4:8023435-8023457 CTGGGCTTATGGGGTTGAGAAGG + Intronic
969845450 4:9916872-9916894 CTGAGTGTCTGGGGGAGAAAAGG - Intronic
973117820 4:46483218-46483240 CTTGTTTTTTGGGGGTGTCAGGG + Intergenic
977328702 4:95609460-95609482 CTGGGCTTCAGGGGTAGACATGG + Intergenic
981297488 4:143148802-143148824 CTGTCTTTCTGGCAGTGACAGGG - Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
985491174 5:180573-180595 AAGGTTTTCTGGAGGTGACAAGG - Intronic
985685174 5:1278055-1278077 CTGGGGTCCTGGGGGTGCCAGGG + Intronic
986741707 5:10710688-10710710 CTTGACTTCTGCGGGTGACAGGG + Intronic
987257211 5:16168348-16168370 TTGGGTAGCTGTGGGTGACATGG - Intronic
987311314 5:16683733-16683755 CTGGATTGCTGGGGTTGACAAGG + Intronic
987871687 5:23627136-23627158 CTGAGTTTCTGGCCGTGATAGGG + Intergenic
991612950 5:68467357-68467379 TTGTGTTTCTGGTGGTGGCAAGG + Intergenic
992204891 5:74421713-74421735 GTGGGCTTCTTGAGGTGACATGG - Intergenic
995359657 5:111280960-111280982 CTGAGTTTCTGGGTGTGATTTGG + Intronic
996411788 5:123166326-123166348 CTGGGTTCCTGAGGGGTACACGG - Intronic
997431307 5:133842998-133843020 CTGAGTTTCTGGTGGTGTCTGGG - Intergenic
999772890 5:154788636-154788658 GTGGGTTTCTGGGGGAGGAAGGG + Intronic
1000288809 5:159850581-159850603 CTGGGTTCCTGGGGGATTCAAGG - Intergenic
1002786006 6:401237-401259 GTGGATCTCTGGGGGAGACAAGG + Intronic
1003110300 6:3247595-3247617 CTGTGTTTCAAGGGGAGACAGGG - Intronic
1003528375 6:6917200-6917222 CTGACCTTCTGGGGGCGACAAGG + Intergenic
1004177848 6:13355773-13355795 CTGCGCTTCTGGCGGTGACTTGG + Intergenic
1006298908 6:33182981-33183003 CTGGGTATTTGGGGTTGATATGG - Intronic
1007355624 6:41313730-41313752 CTGGGTTTCTGTGTGTGGTAGGG + Intergenic
1007775378 6:44222019-44222041 CTGGGTCTGTGGGGGTGGCAGGG - Intronic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1012948379 6:105491847-105491869 CTAGGTTGCTGGGGCTGTCATGG - Intergenic
1013542952 6:111129742-111129764 TTGGGCCTCTGGGTGTGACAAGG + Intronic
1013818920 6:114132808-114132830 CTGGGCTTCTGGTGGTGAATGGG - Intronic
1015493443 6:133854770-133854792 CTGGGTTTCGTGGGGTCACTGGG - Intergenic
1017476901 6:154804779-154804801 CTGGGATTCTGGGTGCCACAAGG - Intronic
1017528708 6:155266449-155266471 CTGGCTTTGTGGGTGTCACAGGG - Intronic
1017962074 6:159232170-159232192 TTGGGTGTCTGAGGGTGACATGG - Exonic
1019007901 6:168817962-168817984 CTGGGTTTCTGGACCTGAGATGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019613080 7:1946748-1946770 CTAGGGTTCTGGAGATGACAGGG + Intronic
1019993633 7:4709240-4709262 GTGGGATTCTCGGGATGACAGGG - Intronic
1020408691 7:7866314-7866336 GTAGGTTTGTGGGGGTGACAGGG + Intronic
1020638263 7:10723284-10723306 ATGAGTGTCTGGGGGTGACCAGG + Intergenic
1021671935 7:23043353-23043375 CTGGGTTTCTGAAAATGACAGGG + Intergenic
1022033790 7:26515776-26515798 CTGGGTTTCTGGCTGTCTCAAGG + Intergenic
1022379246 7:29844181-29844203 CTGGGTATCTGGGGTGGAAAAGG + Intronic
1022888796 7:34674866-34674888 CTGGGTTTCTGGGGCTGGGTTGG - Intronic
1023358051 7:39387116-39387138 CTGGGTTCCTGGGGATGAGCGGG - Intronic
1023495226 7:40788085-40788107 CTGGGTCTCTGGTGGTATCAGGG - Intronic
1023530096 7:41144097-41144119 CTGGGTCACCGGGGGTGTCAGGG + Intergenic
1023889488 7:44382103-44382125 CTGGGCTCCTTGGTGTGACAGGG - Exonic
1024996641 7:55277737-55277759 GTGGGTTTCTGAGGCTGCCACGG - Intergenic
1026110049 7:67451821-67451843 CTTGGCTCCTGGGGGTGCCAAGG - Intergenic
1026120313 7:67530896-67530918 TTGGTTTTTTGGGGGGGACAGGG - Intergenic
1026505703 7:70980734-70980756 CTGGGTTACGGGGCGTGTCAGGG + Intergenic
1028861703 7:95658957-95658979 CTGGGTTTTATGGGGTGAAAAGG - Intergenic
1033651868 7:143350142-143350164 CTGGGTACCTGGGGGTTGCAGGG + Intronic
1034103345 7:148470221-148470243 CTTGGTTTCTGGAGGGGAAATGG - Intergenic
1034875268 7:154719900-154719922 GTGGGTTTCAGGGGGTGCCAGGG + Intronic
1035018682 7:155787820-155787842 GTGGGTTTCTGGGCGTGTCCGGG - Intergenic
1036766508 8:11552798-11552820 CTGGCTTCCTGGGGTGGACATGG - Intronic
1036803868 8:11813912-11813934 CTGGGTTTCTGGGGAAAACGTGG + Intronic
1038097961 8:24336712-24336734 CTGGTTTCCAGGGTGTGACAGGG + Intronic
1039471672 8:37817193-37817215 CTGGGTTCCTGGGAGTGGGAAGG + Intronic
1040414186 8:47182332-47182354 CAGGGCTTTTGGGGGTGACAGGG + Intergenic
1044057811 8:87594105-87594127 CTTGGTTGCTGGGGGTCAGAAGG - Intronic
1044790432 8:95841457-95841479 CTGGGTCTCTTGGGGTACCAGGG - Intergenic
1045409596 8:101903888-101903910 CTGGTATGCTGGGTGTGACATGG + Intronic
1048280788 8:133104128-133104150 CTGGCTGTTTGGGGGTCACAGGG + Intronic
1048595968 8:135866561-135866583 CTGGGTTCCTGGGAAGGACAGGG + Intergenic
1049001849 8:139831307-139831329 CTGGGTTTCCGGGGTGGAGAAGG + Intronic
1049016641 8:139924665-139924687 CTTGGTTCCTGGGGGTGGGATGG - Intronic
1049337784 8:142095789-142095811 CTGGGTCTCTGGGGATGGGATGG - Intergenic
1049483750 8:142840557-142840579 CTGGGGTGCTGGGGGTCACTGGG + Intronic
1049558968 8:143298078-143298100 TTGAGTTTCTTGGGATGACAGGG + Intergenic
1049676360 8:143891034-143891056 GAGTGCTTCTGGGGGTGACAAGG - Intergenic
1050593838 9:7186317-7186339 ATTGGTTTCTGGGTGTAACATGG - Intergenic
1053183529 9:35994742-35994764 CTGGGTTGGGGGGGGGGACATGG - Intergenic
1053419587 9:37969009-37969031 CAGGGTTTCTGTGGGGGACTGGG - Intronic
1056508867 9:87283762-87283784 CTGGGTTTCTGAGTGTGAGAAGG - Intergenic
1056825454 9:89873603-89873625 CAGGGTTTGTGGTGGTGAGAGGG - Intergenic
1057546862 9:96025509-96025531 CTGAGTTTCTGGAGATGACTAGG + Intergenic
1057702677 9:97375220-97375242 CTGGGGTTCTGGGGGGGGAAGGG - Intronic
1057905206 9:98977589-98977611 CTGGGCTGCTGGGGCTGACTTGG + Intronic
1059625527 9:116060857-116060879 CTAGGATTCTGGGAATGACAGGG - Intergenic
1060793401 9:126500162-126500184 CCGGGTTCCTGGGGGTGGCAGGG - Intronic
1060827865 9:126696671-126696693 CTGGGTCCCTGGGGATGACAAGG - Exonic
1061078430 9:128355635-128355657 CTCGGTTCCTGGGGGTGGCAGGG - Exonic
1061091600 9:128429503-128429525 CTGGGTTCCTCGGGGGAACATGG - Intronic
1061376285 9:130226595-130226617 CTGGGTCTCTGGGGGTGTTGTGG + Intronic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1061802228 9:133119013-133119035 CTTGCTTTCTGGAGGTGACCTGG - Intronic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1062590963 9:137274481-137274503 CTGGGTGTCTGGGGCTGGCCTGG + Intergenic
1203416667 Un_KI270330v1:8-30 CTGGGTGCCTGGGGCTGACTGGG - Intergenic
1185629418 X:1505219-1505241 CTGGGTTTCTGTGACTGACGTGG + Intronic
1185667325 X:1776218-1776240 CTGGGTGTCAGGGAGTGACATGG + Intergenic
1185726507 X:2426142-2426164 CAGGGTCTCTAGGGTTGACAAGG + Intronic
1187390694 X:18884844-18884866 CTGAGCTCCTGGTGGTGACAGGG + Intergenic
1187484161 X:19686362-19686384 CTGGCATTCTGGGCCTGACATGG - Intronic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1193818759 X:86136627-86136649 CTGGGTTTCTGGGGAAGGTAAGG + Intergenic
1194475123 X:94348831-94348853 GTGGGTCACTGGGAGTGACAGGG - Intergenic
1195684275 X:107571463-107571485 TTGGCTGTCTGGGGATGACAAGG + Intronic
1195884502 X:109625019-109625041 ATGGCTTTCGGGGAGTGACACGG + Exonic
1196813977 X:119650573-119650595 CTGGGAATCTGTGGCTGACAGGG + Intronic
1197918570 X:131563048-131563070 CTTTTTTTCTGGGGATGACAGGG + Intergenic
1199202737 X:145111912-145111934 CTGGTTTTCTGGAAGTGCCATGG - Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200480760 Y:3700403-3700425 CTAGGTTTCTGGGCCTGTCATGG - Intergenic
1200837906 Y:7750804-7750826 CTGGGTTGCTGGTGGTTACTGGG + Intergenic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic