ID: 1139199122

View in Genome Browser
Species Human (GRCh38)
Location 16:64954777-64954799
Sequence GATCAGAGTGGATCACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139199122_1139199125 7 Left 1139199122 16:64954777-64954799 CCTTCTTGTGATCCACTCTGATC 0: 1
1: 0
2: 2
3: 8
4: 141
Right 1139199125 16:64954807-64954829 AAAAATAAGTCACTATGGCCTGG 0: 1
1: 0
2: 4
3: 81
4: 714
1139199122_1139199127 15 Left 1139199122 16:64954777-64954799 CCTTCTTGTGATCCACTCTGATC 0: 1
1: 0
2: 2
3: 8
4: 141
Right 1139199127 16:64954815-64954837 GTCACTATGGCCTGGCATGGTGG 0: 1
1: 1
2: 9
3: 113
4: 984
1139199122_1139199126 12 Left 1139199122 16:64954777-64954799 CCTTCTTGTGATCCACTCTGATC 0: 1
1: 0
2: 2
3: 8
4: 141
Right 1139199126 16:64954812-64954834 TAAGTCACTATGGCCTGGCATGG 0: 1
1: 0
2: 1
3: 21
4: 259
1139199122_1139199124 2 Left 1139199122 16:64954777-64954799 CCTTCTTGTGATCCACTCTGATC 0: 1
1: 0
2: 2
3: 8
4: 141
Right 1139199124 16:64954802-64954824 TGATCAAAAATAAGTCACTATGG 0: 1
1: 0
2: 2
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139199122 Original CRISPR GATCAGAGTGGATCACAAGA AGG (reversed) Intronic
900714968 1:4138310-4138332 GCTCAGAGTGGAAAACAAGGCGG - Intergenic
902560005 1:17271335-17271357 GATCAGCGTGGGTCTCCAGAAGG - Intronic
905079847 1:35308561-35308583 GTTAAGAGTGGATGATAAGACGG + Intronic
909041166 1:70653948-70653970 GTTCAGTGTGGATCACTGGAAGG + Intergenic
909714485 1:78691477-78691499 GAGCAGAGAGGATTTCAAGAAGG + Intergenic
910354157 1:86335775-86335797 GAACAGAGTGTATTACAAAATGG - Intergenic
913069605 1:115286769-115286791 GATCAGAGTGTAGAACAACATGG + Exonic
919047708 1:192474584-192474606 GATCAGAGTGGCGCTCAAAAAGG - Intergenic
922905672 1:229171849-229171871 CATCAGTCTGGATCAAAAGAGGG + Intergenic
1063428639 10:5968661-5968683 GATCAGTGTGGAGCAGAACATGG - Intronic
1065505048 10:26421871-26421893 GATGACAGAGGGTCACAAGAGGG - Intergenic
1072948374 10:99831193-99831215 AATCAGAGTGGAACAGATGATGG - Intronic
1073926789 10:108525738-108525760 GATCAGAGTGCAACACACAACGG + Intergenic
1074214678 10:111372813-111372835 GGTCAGAGTGGAACCAAAGATGG + Intergenic
1077660537 11:4064700-4064722 GATCAGACTGGCTCAGCAGAGGG + Intronic
1079797581 11:24825404-24825426 GAGGAGAGAGGATCAGAAGAGGG - Intronic
1080171676 11:29311096-29311118 GACCAGAGTGGATGAGAAGTTGG + Intergenic
1082180210 11:49107799-49107821 GACCAGAATGGCTCATAAGAGGG + Intergenic
1083145541 11:60755670-60755692 GCTCAGAGTGGATCACCAGAGGG - Intergenic
1088517262 11:110651371-110651393 GATCAGAGTGGAACTGAAGAAGG + Intronic
1089055417 11:115581077-115581099 GATCACAGTAGATTAAAAGAGGG - Intergenic
1090602180 11:128384635-128384657 CATCAGAGTGGATTACAGAAGGG - Intergenic
1094042823 12:26135248-26135270 GGGCTGAGTGGATCACAGGAGGG + Intronic
1096499716 12:52057303-52057325 GATCAGGGTGGTTCACAGGCAGG - Intronic
1096786701 12:54021056-54021078 GATCAGAGTGGTTAATAAGGTGG + Intronic
1097800654 12:63910512-63910534 GATCAAAATGGGTCAGAAGAGGG - Intronic
1099140303 12:78965721-78965743 GATGAGAGAGTATCACATGATGG - Intronic
1099644103 12:85328315-85328337 GACCAGAGTGTATCAAAAGGAGG - Intergenic
1101900838 12:108790029-108790051 GATCACAGTGGCTCAGAGGATGG - Intronic
1105067024 12:133209857-133209879 GATCACCCTGGATCCCAAGAGGG - Intergenic
1105271649 13:18881959-18881981 GATCTGAGAGGATGACAAAAGGG + Intergenic
1105612183 13:21978115-21978137 CCTCAGAGTGGATGACAGGAAGG - Intergenic
1107274876 13:38666915-38666937 AATCACAGTGGAAGACAAGAAGG - Intergenic
1120001065 14:79303587-79303609 GACCTCAGTTGATCACAAGAGGG - Intronic
1121841969 14:97142008-97142030 GAAAAGAGAGGATCCCAAGAAGG - Intergenic
1123707710 15:22962299-22962321 GCTCACTGTGGATCACAAGCAGG - Intronic
1124848362 15:33312271-33312293 GAGGAGAGTGGTTCAAAAGATGG - Intronic
1126896643 15:53264620-53264642 GATGGGAGTTGATCACCAGAAGG - Intergenic
1128445051 15:67751952-67751974 GAACAGAGGCAATCACAAGAGGG - Intronic
1130214016 15:81951686-81951708 GTTTAGAGTGTATCACAGGATGG - Intergenic
1131836207 15:96393975-96393997 GATCACAGTTGATTACAAGTGGG - Intergenic
1132110987 15:99102353-99102375 GAGCAGAATGGATCCCAGGAGGG - Intronic
1134559698 16:15197763-15197785 GATCAGAGTGCATTAGAAGCTGG + Intergenic
1134920237 16:18109374-18109396 GATCAGAGTGCATTAGAAGCTGG + Intergenic
1139199122 16:64954777-64954799 GATCAGAGTGGATCACAAGAAGG - Intronic
1141870383 16:86781327-86781349 CATGAGAATGGATCACAGGAAGG - Intergenic
1142916153 17:3140340-3140362 GATCAGAGTGGAACTGAAGGAGG - Intergenic
1145832711 17:27929998-27930020 CTTCAGAGTACATCACAAGAAGG + Intergenic
1146498383 17:33343317-33343339 CATCAGAGAGGATTAGAAGAGGG - Intronic
1147839862 17:43363610-43363632 GATCAGAGTGGCTCCCAGGCAGG - Intergenic
1149050954 17:52304235-52304257 AAGCAGAGTGGAGAACAAGATGG + Intergenic
1152201570 17:78950093-78950115 GCTCAGAGTGGATCACCTCATGG + Intergenic
1156501363 18:37561267-37561289 GTTCTGACTGGATAACAAGAGGG + Intronic
1157797728 18:50590487-50590509 GATCAGAGCTGATCAGAAGGTGG + Intronic
1159379338 18:67636689-67636711 GAGCAGTGTGGCTCAGAAGAAGG - Intergenic
1160887881 19:1360434-1360456 GTGCAAAGTGGACCACAAGAAGG + Exonic
1162879109 19:13644762-13644784 AATCAGAGTGAATCTCAGGATGG - Intergenic
1163678747 19:18668804-18668826 GATCTCAGTGGAGGACAAGAAGG + Exonic
1167144595 19:47674095-47674117 GATCAGAAAGGGTCACACGAGGG + Intronic
925844592 2:8024082-8024104 GCTCAGAGAGGGTCACCAGATGG + Intergenic
925844638 2:8024408-8024430 GCTGAGAGTGCCTCACAAGATGG + Intergenic
927695000 2:25233710-25233732 GATCAGATAGGAGCACAAGCAGG - Exonic
928618900 2:33069407-33069429 GATCAAAATGGATCATAAGTGGG - Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
930394548 2:50804527-50804549 CATCAGTGTGGAAAACAAGACGG - Intronic
933288660 2:80412106-80412128 GATCATTGTGGATCTCCAGATGG - Intronic
933346142 2:81088104-81088126 TAGCAGAGTGCATCACAAGCAGG - Intergenic
940604244 2:155899602-155899624 TCTCAGAGTAGATCAAAAGAGGG + Intergenic
942379780 2:175376787-175376809 GATCAGAGTGGAGCAAGGGAAGG - Intergenic
943034901 2:182730913-182730935 ACTCAGAGTGGATTAGAAGAGGG + Intronic
943527220 2:189031421-189031443 GAGAAGAATGGATCAGAAGAGGG + Intergenic
944890491 2:204112113-204112135 GAGCAGTGTGGATTACAAGACGG + Intergenic
945350166 2:208768339-208768361 GAGCAGAGTGGCTCAGAATATGG + Intronic
945711126 2:213296415-213296437 GAGCAGACTGGATGACAGGAAGG - Intronic
947375384 2:229489999-229490021 GATCAAAGTGGAGGACAAGAGGG + Intronic
1172067985 20:32234935-32234957 GAGCAGAGTGGACCAGAAGACGG - Exonic
1172541481 20:35720791-35720813 TACCAGAGTGGATCAGAAGTGGG + Intronic
1173371714 20:42442257-42442279 CATCAGAGTGCATTACAAGGAGG - Intronic
1179330148 21:40392430-40392452 GATGAGAGTGGATTAGAAAATGG + Intronic
1181003707 22:19999632-19999654 GTTCAGAATGGATCAGAGGATGG + Intronic
1182021779 22:27087536-27087558 GATTAGAATGGATGACGAGATGG - Intergenic
1183481361 22:38067238-38067260 GATCAGACAGGGTCACAAGGTGG + Intronic
1183499145 22:38168052-38168074 AAACAGTGTGGATCACAAGGAGG - Intronic
949757298 3:7426918-7426940 GATCAGATTGGAGGAGAAGAAGG + Intronic
953128127 3:40111186-40111208 GCTCAGGATGGTTCACAAGAAGG + Intronic
953250309 3:41239868-41239890 CACAAGAATGGATCACAAGATGG + Exonic
955677436 3:61463367-61463389 CAGCAGAGTGGATCACAGCAAGG - Intergenic
955727965 3:61952897-61952919 GACAACAGTGGGTCACAAGAGGG - Intronic
956685346 3:71821832-71821854 TATCAGAGTTCATTACAAGAGGG - Intergenic
959256498 3:104021705-104021727 GATCAGAGTGTAACTGAAGAAGG + Intergenic
960412743 3:117347872-117347894 GATAAGAGTGCTTCACAAGGAGG + Intergenic
963054899 3:141178196-141178218 GCTAAGAGTGGATCCAAAGAAGG - Intergenic
964775537 3:160272538-160272560 GATCAGAAGGGATGAAAAGATGG - Intronic
973755513 4:54069604-54069626 GATGAGAGCTGATCACCAGAAGG - Intronic
976701319 4:87971850-87971872 AATCAGAGAGGATCCAAAGAGGG - Intergenic
977042670 4:92034190-92034212 GATCTGTGTAAATCACAAGAAGG - Intergenic
980778943 4:137471682-137471704 GTGCAGAGTGGATGACAAGGAGG + Intergenic
982464401 4:155712501-155712523 GATCATCCTGGACCACAAGAAGG - Intronic
983475362 4:168206052-168206074 GATTAGAGTGGAATAGAAGAAGG - Intergenic
985884339 5:2664977-2664999 GAACAGAGAGGAGCAGAAGAAGG + Intergenic
991199287 5:63972674-63972696 GATCAGAGTGGAACTGAAGGAGG + Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
992762410 5:79962300-79962322 GATCAGAATGGTTCACATGGTGG + Intergenic
993086640 5:83371047-83371069 AATCAGAGTGGATGACAAAGAGG - Intergenic
993875650 5:93303639-93303661 GCACAGACTGGATCACAAGACGG - Intergenic
994982722 5:106897690-106897712 GATCAGAGTGGGTAAAAACAGGG + Intergenic
1001583332 5:172815385-172815407 GATCAGAGTGGGGCATGAGAGGG + Intergenic
1002261458 5:177996358-177996380 GCTCAGGGAGGATCACAAGCCGG + Intergenic
1007749773 6:44064752-44064774 GATCACAGGAGATCACAGGAGGG + Intergenic
1012579713 6:100852061-100852083 GATCAGATTGGAGCAGACGAAGG + Intronic
1012907548 6:105085591-105085613 GAGCAGAATCGATCACAAAATGG - Intergenic
1013086813 6:106864149-106864171 AATCAGAGTGGGTCAGGAGAAGG + Intergenic
1013210504 6:107982812-107982834 GAGCAGAGTGGATTAGATGAAGG + Intergenic
1013510446 6:110840048-110840070 CTTCAGACTGGATAACAAGAGGG - Intronic
1015090210 6:129347029-129347051 GAACAGAGTGAATGAGAAGAGGG + Intronic
1015858196 6:137648046-137648068 GATGAGACTGGATCACACAAAGG - Intergenic
1015973161 6:138762928-138762950 GATGAGTATGGATCACAGGAAGG + Intronic
1017763172 6:157586595-157586617 GATCAGAATGGGTGGCAAGACGG + Intronic
1018911532 6:168103174-168103196 GATCAGAGTGGACCAAGAGTGGG - Intergenic
1020140499 7:5608882-5608904 GATCACAGTGAATCCCAACAAGG - Intergenic
1021745470 7:23736553-23736575 GATCACAGGGGATCACAGGACGG + Intronic
1022008225 7:26286736-26286758 GACCTGAGTGGATCAAAGGAAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026670004 7:72381980-72382002 GTTCAAAGTGGATCACAACTTGG + Intronic
1029458502 7:100682793-100682815 GATCAGAGTGGCTCAAACAAAGG + Intronic
1030076313 7:105740043-105740065 AAACAGAGTGGATCACAGTAAGG - Intronic
1032060114 7:128717010-128717032 GATGAGAATGGAGGACAAGAGGG + Intronic
1032795276 7:135271311-135271333 GATCTGAGTGGATAACAGCACGG - Intergenic
1034152100 7:148925062-148925084 TATCAGGGCAGATCACAAGATGG + Intergenic
1037563118 8:20092549-20092571 GGTCAGAGAGGAGAACAAGAGGG - Intergenic
1037565511 8:20114877-20114899 AATCACAGTGGATCAGATGAAGG - Intergenic
1040941364 8:52836645-52836667 GATCAGAGTGGTGGCCAAGAAGG + Intergenic
1044327256 8:90873450-90873472 GATGAGAGTGGACCACAACTTGG - Intronic
1044562128 8:93622737-93622759 GATCAGAGTGGTTCACAGAAAGG - Intergenic
1045920027 8:107518622-107518644 GATCAGAGTGGGTGATGAGATGG - Intergenic
1051653205 9:19351151-19351173 GATCAGAATAGATCATAAGGCGG - Intronic
1052927395 9:34029293-34029315 GAGGAGGGTGGATCACCAGAAGG + Intronic
1059014710 9:110503505-110503527 GATTAGAGGTGATCACAAAAGGG + Intronic
1059525749 9:114989549-114989571 GATAAGAGAGGACCCCAAGAAGG - Intergenic
1061444891 9:130632184-130632206 GACCACTGTGGATAACAAGAGGG - Exonic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186274118 X:7921510-7921532 GATCACAGTGCATCATAAGGCGG + Intronic
1186381097 X:9060069-9060091 GATAGGAGTGGATCACAGGTGGG - Intronic
1187098853 X:16171760-16171782 CATCAGTTGGGATCACAAGATGG + Intergenic
1187243995 X:17537910-17537932 GATCAGAGGGGAAAACAAAAGGG + Intronic
1188397273 X:29701176-29701198 TATCAGAGTGGTTAAGAAGATGG + Intronic
1189896939 X:45665425-45665447 ACTCAGAGTTGATCACCAGAAGG - Intergenic
1191960283 X:66693119-66693141 GATCAGAGTGGCAGCCAAGATGG - Intergenic
1193626679 X:83830497-83830519 GATTAGAGTGGATCAGAACAGGG + Intergenic
1194814087 X:98421575-98421597 GATCATAATGGAGTACAAGAGGG + Intergenic
1198613259 X:138425443-138425465 CTTCAGAGAGGATCCCAAGAGGG + Intergenic
1199781757 X:151067831-151067853 GATCAGAGGGAAAAACAAGAGGG - Intergenic