ID: 1139199893

View in Genome Browser
Species Human (GRCh38)
Location 16:64963973-64963995
Sequence AAGAACATGGGTCAGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139199887_1139199893 17 Left 1139199887 16:64963933-64963955 CCTGCCTTGTAAGAAATGTTAGA 0: 1
1: 9
2: 70
3: 237
4: 578
Right 1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG 0: 1
1: 0
2: 2
3: 25
4: 277
1139199888_1139199893 13 Left 1139199888 16:64963937-64963959 CCTTGTAAGAAATGTTAGAATAA 0: 1
1: 1
2: 29
3: 144
4: 594
Right 1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG 0: 1
1: 0
2: 2
3: 25
4: 277
1139199886_1139199893 25 Left 1139199886 16:64963925-64963947 CCAGTAGGCCTGCCTTGTAAGAA 0: 1
1: 13
2: 64
3: 234
4: 1107
Right 1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG 0: 1
1: 0
2: 2
3: 25
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139199893 Original CRISPR AAGAACATGGGTCAGAAATC TGG Intronic
900519756 1:3099915-3099937 ACAAAGATGGGCCAGAAATCGGG + Intronic
901379998 1:8866659-8866681 AAAAACATGAGTCAGAGACCTGG - Intronic
902136218 1:14308032-14308054 AAGAACATGTCACAGAAAACTGG + Intergenic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
903520897 1:23948860-23948882 AAAAATAGGGGACAGAAATCAGG - Intergenic
903992523 1:27283605-27283627 AAGAACATGGAAGAGAAATGAGG - Intronic
906489059 1:46253670-46253692 AAAAATAGGGGACAGAAATCCGG - Intronic
906668070 1:47635652-47635674 AAGAACCAGGCTCAGAAAACAGG - Intergenic
908193365 1:61725627-61725649 AAGAGCATAGATCTGAAATCTGG - Intergenic
908427356 1:64020268-64020290 AAGAACATGGGTTTGAATTCTGG - Intronic
909642979 1:77888080-77888102 AAGAGCGTGGGGCAGCAATCCGG - Intergenic
909701346 1:78527128-78527150 AAGACTGTTGGTCAGAAATCTGG + Intronic
910964797 1:92797549-92797571 TAAAACATGAGTCAGAAAGCTGG - Intergenic
912085707 1:106000593-106000615 ATGAATATGGGGCAGACATCAGG - Intergenic
912556017 1:110516459-110516481 AAGAAGATGTGTCAGAATTGGGG - Intergenic
916005695 1:160658049-160658071 AAGAACATGGGTCCTTAATTTGG + Intergenic
916172369 1:162010673-162010695 ATGACCATGGGGCAGAATTCTGG + Intronic
917208682 1:172607481-172607503 AAGGGAATGGATCAGAAATCAGG - Intronic
917255548 1:173112120-173112142 AAGAACATGGGCCAGACTACAGG - Intergenic
917327922 1:173852450-173852472 AACTTCATGGGTTAGAAATCCGG - Intronic
917587354 1:176441048-176441070 AAGAACAGAGGTCAGAAATTTGG - Intergenic
917625419 1:176841186-176841208 TGGAACAAAGGTCAGAAATCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918915976 1:190637572-190637594 AAAAACACAGATCAGAAATCTGG - Intergenic
919934553 1:202243041-202243063 CAGAGCCTGGGTCAGAAGTCAGG + Intronic
920056203 1:203194065-203194087 TAGAATAAGGGTCAGAAAACTGG - Intergenic
921305925 1:213796798-213796820 AAGAAGAGGGGAAAGAAATCGGG - Intergenic
921857561 1:220003121-220003143 AATAACAAGGGTTAGAAATGTGG - Intronic
922497639 1:226071619-226071641 AAAAATAGGGGACAGAAATCAGG + Exonic
922928400 1:229369912-229369934 AAGAACATGGGTCATATTTAAGG - Intergenic
923023309 1:230184051-230184073 AATAACATCGATCAGAAACCTGG - Intronic
924365834 1:243292371-243292393 AAGCACTTGTGTCAGAAACCCGG + Intronic
1063523284 10:6760230-6760252 AACATCATGGGTCAGAATTTGGG - Intergenic
1063976155 10:11417336-11417358 AACAACATAGGTCAGAAACTAGG + Intergenic
1064824995 10:19388287-19388309 AAGAACTGGGGTTAGAACTCTGG + Intronic
1065503497 10:26405324-26405346 AAGAGCATGGCTCAGATACCTGG + Intergenic
1065653979 10:27927277-27927299 AAAAACTTGGGTCACATATCAGG - Intronic
1066412603 10:35188225-35188247 CAGATCCTGGGTTAGAAATCTGG - Exonic
1068463220 10:57353842-57353864 AAGCAGATGGGCCAGAAAACTGG - Intergenic
1071887168 10:89963857-89963879 AAGAAGATGGGTCAGAGATGTGG + Intergenic
1071958972 10:90789786-90789808 CAGAACATGGATTTGAAATCTGG - Intronic
1072324905 10:94288354-94288376 AAGATCGTGGGTCAGAGACCTGG + Intronic
1072943109 10:99785206-99785228 AAAAACTTGGGTCCGAAATAAGG + Intronic
1073991378 10:109266000-109266022 AAGGACAAGGGCCAGAACTCAGG + Intergenic
1074049326 10:109867896-109867918 AGAAACAAGGGTCAGAAATGGGG - Intronic
1074453266 10:113576463-113576485 ATGAGCATGGGCCAGAAGTCAGG - Intronic
1074786189 10:116843584-116843606 AAGAACCAGGGTTAGAACTCAGG + Intergenic
1075206678 10:120455172-120455194 AAACACATGCTTCAGAAATCTGG - Intergenic
1076119671 10:127925529-127925551 GAGAACAAGGCTCAGAAAACAGG + Intronic
1077142648 11:1031222-1031244 AAGTACATGGGTCAGATGTGCGG - Exonic
1078510417 11:11980539-11980561 AAAAGCATGGGCCAAAAATCTGG - Intronic
1079468699 11:20757773-20757795 GAGAACATGGCTCTCAAATCAGG - Intronic
1080559425 11:33449285-33449307 AAGAAAAAGTGTGAGAAATCAGG - Intergenic
1081287964 11:41295759-41295781 AAGAAAATGGGTTAAACATCAGG - Intronic
1082730921 11:56796511-56796533 AACAACATGGGTTTGAACTCTGG - Intergenic
1082947792 11:58778466-58778488 AAGAACTTGTTTCATAAATCTGG - Intergenic
1084619355 11:70258375-70258397 AACAACATGGGGCAGAAGTATGG - Intergenic
1085737678 11:79053592-79053614 GAGAACATGGGTCTGACTTCTGG - Intronic
1085796069 11:79541132-79541154 AAGTTCATGGTTCAGAATTCAGG - Intergenic
1086420849 11:86635681-86635703 AAGAACATGGTTCTGGAATCTGG - Intronic
1087559373 11:99765843-99765865 AAGAACATGGATCTGTATTCTGG + Intronic
1088146547 11:106687485-106687507 CAGAACATGGGTCACCAATGGGG - Exonic
1088740886 11:112765888-112765910 AAGACTATGGGTTAGAAATAAGG + Intergenic
1089052567 11:115558392-115558414 AAGGACATGGGCCTGGAATCCGG + Intergenic
1089651042 11:119913253-119913275 AAGAACATGGTTAAGATCTCTGG - Intergenic
1090261731 11:125326204-125326226 AAGATCAAGGGTCAGTAATAGGG + Intronic
1090599399 11:128354871-128354893 AAGACCAGGGCTTAGAAATCAGG - Intergenic
1092207700 12:6625754-6625776 AAGAAAATAAGTCATAAATCTGG + Intronic
1093316035 12:17650933-17650955 AAGAAAATGTGGCAGAAACCAGG + Intergenic
1093882884 12:24425757-24425779 AAGTACATGAGTCAGACATTTGG + Intergenic
1093934039 12:24982419-24982441 AAGAGCATGGCTCTGATATCTGG + Intergenic
1095121901 12:38429160-38429182 AATAACATGGATCTGAAACCCGG + Intergenic
1095285721 12:40407898-40407920 TAGAACATGGTCCAGAAATGGGG + Intronic
1096688597 12:53305682-53305704 ATGAGCATGGATTAGAAATCAGG + Intronic
1097069463 12:56344244-56344266 AAGAGCATGGGTTTGGAATCAGG + Intronic
1097148268 12:56956831-56956853 AAGAGCCTGGGTTAGAGATCTGG - Intronic
1097157740 12:57025351-57025373 AAGAACATGGGCCAGAACCCAGG + Intronic
1101563707 12:105884643-105884665 AAGACAATGGGGCAGAAAGCAGG + Intergenic
1101937854 12:109072994-109073016 AAGAACATAAGTGAGAAACCTGG - Intronic
1102564758 12:113789000-113789022 AATAACATGGGGCAGAGATATGG + Intergenic
1105444130 13:20437873-20437895 AAGAACATGGGTTAGAAATTAGG + Intronic
1106673798 13:31935620-31935642 AAGAAAATGGCCTAGAAATCAGG + Intergenic
1107583593 13:41819276-41819298 AAGAACATGGTTAAGAATTCTGG + Exonic
1107731695 13:43355652-43355674 GAGAACATGGGTGAGCATTCTGG + Intronic
1108478848 13:50846568-50846590 AAGAACATGTGACACAATTCTGG - Intergenic
1108728335 13:53205091-53205113 GAGAAGAGGGGTAAGAAATCAGG - Intergenic
1110105912 13:71675615-71675637 AAAAATAGGGGACAGAAATCAGG + Intronic
1110180986 13:72616446-72616468 AAGCACATGGCTAAGGAATCAGG + Intergenic
1111892583 13:94102489-94102511 AAAAAAAAGGGTCAGAAAACAGG - Intronic
1113146315 13:107211973-107211995 CAGAACATGGGTTTGAAGTCTGG - Intronic
1113196345 13:107811726-107811748 AAGAATATGGCCCAGACATCTGG + Intronic
1113511908 13:110863262-110863284 AAGAACCTGGTTCAGAAGTCAGG + Intergenic
1114852228 14:26395003-26395025 AAGAACAAGGATCATCAATCAGG - Intergenic
1115407625 14:33036146-33036168 AAGCAGAAGGGTCAGAATTCTGG + Intronic
1115580249 14:34750864-34750886 AAAAACATGAGTCAGAGAACTGG - Intergenic
1116280288 14:42898242-42898264 AAGAACATGTTTTATAAATCTGG + Intergenic
1117182781 14:53209298-53209320 GAGAACAGGTGCCAGAAATCTGG - Intergenic
1117718989 14:58609956-58609978 AGTTCCATGGGTCAGAAATCTGG + Intergenic
1118368292 14:65114268-65114290 AAGAACATTGGGCAGAACTAAGG + Intergenic
1118629674 14:67691127-67691149 AACCACTTGGGTAAGAAATCTGG - Exonic
1119149641 14:72346765-72346787 AAGAACATGGGGGAGAACCCAGG - Intronic
1119221524 14:72912036-72912058 AGGACGATGGGGCAGAAATCTGG + Intergenic
1121962139 14:98271095-98271117 AGGAACATGGATTATAAATCAGG + Intergenic
1122473660 14:101990432-101990454 AAGAACATAAGTCAGACAGCAGG - Intronic
1123159646 14:106265605-106265627 AAGAACATTTGTCAGAAGTTTGG - Intergenic
1124143042 15:27094271-27094293 GAGACCAGGGGTCAGAAAGCCGG + Intronic
1124246883 15:28078728-28078750 AGTTTCATGGGTCAGAAATCTGG - Intronic
1124551168 15:30682596-30682618 AGGACCATGGGGCAGAAGTCAGG - Intronic
1124680076 15:31723058-31723080 AGGACCATGGGGCAGAAGTCAGG + Intronic
1125972082 15:43920074-43920096 AAAAACATGGCTCAGAATTTTGG - Intronic
1126116873 15:45216080-45216102 AAAAATAGGGGACAGAAATCAGG + Intergenic
1127821041 15:62656435-62656457 GAGAATGTTGGTCAGAAATCAGG + Intronic
1129750022 15:78056261-78056283 AAGAACAAAGGTCAGAGAGCAGG + Intronic
1130052173 15:80493044-80493066 AAGACCATGGTTCTGACATCTGG + Intronic
1130862153 15:87900747-87900769 GAGAGCATGGGCCAGAATTCAGG + Intronic
1131362966 15:91810718-91810740 AATAATATGGGTCAGAAGTTTGG + Intergenic
1131706582 15:95002545-95002567 AAGAAGGTGGGACAGAAATATGG - Intergenic
1132084466 15:98895905-98895927 TAGAACAAGGGTCAGAAAGTTGG - Intronic
1133024454 16:2981859-2981881 TAGAACATCGGACAGAGATCAGG - Intergenic
1134067480 16:11238369-11238391 AACAGCATGGGTCAGAGGTCAGG - Intergenic
1137868116 16:51922475-51922497 AAGAATATGAGTGAGAAGTCAGG + Intergenic
1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG + Intronic
1139657617 16:68398382-68398404 AAAACCATGTGTCAGAAAGCTGG + Intronic
1140621623 16:76740933-76740955 AAGAACAAGTGTAAGAATTCTGG + Intergenic
1140649700 16:77073619-77073641 AATAATATAGGTCAGAAATTTGG + Intergenic
1142536440 17:620030-620052 AAAAAAATGGGTCACAAAACAGG - Intronic
1145832671 17:27929611-27929633 AAGAATATTAGTCAGAAATGGGG + Intergenic
1147677165 17:42215535-42215557 AAGAACATGGGCTTGACATCGGG - Intronic
1148108342 17:45131231-45131253 TAGAACTTGGGGCAGAATTCAGG - Intronic
1149333451 17:55609706-55609728 GAGAACATGGGTCAAACACCAGG + Intergenic
1149886531 17:60345623-60345645 CAGAAGATGGGTAAGAAATCAGG + Intronic
1150940456 17:69687740-69687762 AAGAACCAGGGTAAGAACTCTGG - Intergenic
1151323230 17:73364020-73364042 AAGAACAAGGGGCAGAGACCTGG - Intronic
1153532465 18:6062095-6062117 AATTATATGGGTCAGAAACCCGG - Intronic
1156625571 18:38903513-38903535 TATGACATGGGGCAGAAATCAGG + Intergenic
1157586751 18:48805947-48805969 ATGAAGATGGCTCAGAAAACAGG + Intronic
1158053414 18:53251165-53251187 AACAACATCTGTCAGAAAGCAGG - Intronic
1161066943 19:2243336-2243358 AGGAAGATGGCTCAGAACTCGGG - Intronic
1163742097 19:19021533-19021555 ACGAACAAGGGTCAGAAAGTGGG + Intronic
1164743241 19:30592409-30592431 AAGAAAATGGGTCAGGCATGTGG + Intronic
1168512710 19:56986222-56986244 AAGGACATTGGCCAGAAATTAGG - Intergenic
924987275 2:283598-283620 AAGAAAGTGGGTCAAAAGTCAGG + Intronic
925433053 2:3813562-3813584 AAGAACTTGGTTCATGAATCTGG + Intronic
925467314 2:4118641-4118663 AAGAACATGCTTTATAAATCTGG + Intergenic
926387863 2:12355377-12355399 CAGAACATGGATCTGAACTCAGG + Intergenic
927004994 2:18839299-18839321 AAGAACATGTGCCTGAATTCTGG + Intergenic
927095236 2:19743168-19743190 AGGAGCATGGGTTAGAATTCTGG + Intergenic
927653886 2:24929198-24929220 ATGAAAATGGGTCAGCAATATGG - Intergenic
928108036 2:28485268-28485290 AAGAACGAGGGGCAGAATTCTGG + Intronic
930023374 2:47014735-47014757 ATGAGCAGGGGACAGAAATCTGG + Intronic
933941995 2:87252765-87252787 AAGAACATGGACCAGCAAACAGG - Intergenic
934988418 2:98903415-98903437 AACAAAATGGGTTTGAAATCAGG - Intronic
935011746 2:99142042-99142064 AGGAATATCGGTCAGGAATCTGG - Intronic
935491879 2:103731612-103731634 AAGAACTTGTTTCATAAATCTGG + Intergenic
935983101 2:108645984-108646006 AAGAACATGCGTTATGAATCTGG - Intronic
936338227 2:111608805-111608827 AAGAACATGGACCAGCAAACAGG + Intergenic
936541226 2:113353643-113353665 AGTATAATGGGTCAGAAATCTGG + Intergenic
938892042 2:135715509-135715531 AAGAAAATGGGTCAGCATTTTGG - Intronic
941442340 2:165553927-165553949 AAGCAGATGGGTAAGAAATGGGG - Intronic
942319117 2:174720457-174720479 AAAAATAGGGGACAGAAATCAGG + Intergenic
942984314 2:182121229-182121251 AAGAAACTGAGTCTGAAATCTGG - Intronic
944830101 2:203525152-203525174 AGGAAAATGGATAAGAAATCTGG + Intronic
946311555 2:218884869-218884891 GATAACATGGGTCAGAAAAGGGG - Intronic
947414487 2:229879848-229879870 AAGTACCTGGCTCACAAATCAGG + Intronic
947419071 2:229925191-229925213 AAGAAAATGGATCAGAATTTAGG - Intronic
1169935267 20:10877059-10877081 AAGAAAATGGGTCCTAACTCTGG + Intergenic
1170027923 20:11910980-11911002 AAGATGATGGCTCAGAATTCTGG - Intronic
1170147440 20:13192215-13192237 AATAACATGGATCTGAAATTTGG + Intergenic
1172411566 20:34727696-34727718 AAGAAAATGGGTGAGGAATTAGG - Intronic
1175245164 20:57577891-57577913 AAGTCCATGGATCAGAAACCGGG + Intergenic
1177462591 21:21432231-21432253 AAGAAGTAGCGTCAGAAATCTGG + Exonic
1177739318 21:25135230-25135252 GAGAACATGGGGAGGAAATCTGG + Intergenic
1177952623 21:27557675-27557697 AAAAAGAGGGGTCAGAAATGAGG + Intergenic
1179042936 21:37820556-37820578 CAGAACATAGGTCAGAAGTGAGG - Intronic
1182107718 22:27701128-27701150 GAGAGCCTGGGTCTGAAATCTGG - Intergenic
949601324 3:5601031-5601053 AAGAACCTGGGCAAGAACTCTGG + Intergenic
951851433 3:27145608-27145630 AAGAACTTGGGTGAGAAACTGGG + Intronic
952232451 3:31445919-31445941 AATAACATGGGTTGCAAATCTGG + Intergenic
955981491 3:64531909-64531931 GAGAACGTGGGGCAGAAACCCGG - Intronic
958110189 3:89132502-89132524 AAGAACATTGGTTAGAATTGAGG + Intronic
960043724 3:113175898-113175920 AACAATATGGGTCAAAATTCTGG + Intergenic
960463356 3:117964602-117964624 CAGAATATGGGTCAAAAAGCAGG + Intergenic
960615482 3:119592111-119592133 AAGAACATGAGTCTAAAATGGGG + Intergenic
962331440 3:134482551-134482573 CAGAACATGGCTCAGAAAATCGG + Intronic
962814252 3:138984211-138984233 AAGAGCATGGGTCTGAAATGAGG + Intergenic
962937613 3:140095365-140095387 AAGAATATGGTTAAGCAATCTGG - Intronic
963219464 3:142791584-142791606 AAGAACCTAGGTCAGATATAAGG - Intronic
963323128 3:143831334-143831356 AGGAATCTGGGTCAGAAATCAGG - Intronic
963922679 3:150921158-150921180 AATAAAATGGGTTAGAAATTGGG + Intronic
964851169 3:161097660-161097682 AAGACCATGGGGCAGAAAGAAGG - Intronic
965186175 3:165467217-165467239 AATTCCATGGGTCAGAACTCCGG - Intergenic
966133721 3:176674212-176674234 AAGAGCTTAAGTCAGAAATCTGG + Intergenic
966411292 3:179648965-179648987 AAAAATAGGGGACAGAAATCAGG - Intergenic
967415848 3:189217705-189217727 AAGACCATGGTTCAGGCATCTGG + Intronic
969910260 4:10438105-10438127 AAAAACAAGTTTCAGAAATCTGG - Intergenic
970213051 4:13730984-13731006 GAGAACATGGGTTAGGATTCAGG - Intergenic
970346922 4:15161328-15161350 CACAACATGGCTCAGAACTCAGG + Intergenic
971198073 4:24488172-24488194 AAGTACATGGGTGTGAAATCGGG + Intergenic
971474560 4:27060110-27060132 ATGGACATGGGTTAGAAATCTGG + Intergenic
971622031 4:28867722-28867744 AAGAAAATGGCTGAGAAATTAGG - Intergenic
973804787 4:54515283-54515305 AAGAGCATGGGGCTGACATCTGG + Intergenic
975490668 4:74984980-74985002 AAGGACATGAGTAAGCAATCAGG + Intronic
977020951 4:91759076-91759098 AAGGTCATAGCTCAGAAATCTGG - Intergenic
977774679 4:100902937-100902959 AAGAACTTGCTTCATAAATCTGG - Intergenic
980986271 4:139697986-139698008 AAAAATAGGGGACAGAAATCAGG - Intronic
981674402 4:147324476-147324498 ATGAACACGGGTGAGAAACCTGG - Intergenic
984302242 4:177936412-177936434 AACAACATGTATCAGAAAGCAGG - Intronic
984748606 4:183249800-183249822 AAGAAGATGGTACTGAAATCGGG - Intronic
984861265 4:184241916-184241938 AAGAAAATATGTCAGAAATTTGG - Intergenic
986451941 5:7874219-7874241 AACAACATAGGTCACAAGTCAGG - Intronic
986541503 5:8849559-8849581 AAGAACATTGGTCAGGTATATGG + Intergenic
987671617 5:21016803-21016825 AAGACCAAGTGTCAGAAAACAGG + Intergenic
987889454 5:23857339-23857361 AAGAACTTGGGTTATGAATCTGG - Intergenic
988686346 5:33529198-33529220 GAGAACAAGGGTTAGAACTCAGG - Intronic
989268406 5:39503986-39504008 AAGAAAATGGGGCAGAAGTAAGG - Intergenic
990037576 5:51340796-51340818 AAGAACATGTCTCTAAAATCAGG - Intergenic
992904302 5:81330832-81330854 AATAGCATGGATGAGAAATCCGG + Exonic
993586019 5:89729265-89729287 AAGAATATAGGTCTGAAAACCGG + Intergenic
993996404 5:94728748-94728770 AAGAAAATGAGAGAGAAATCAGG - Intronic
994046316 5:95314321-95314343 AAGAACATTGGTTATAATTCTGG + Intergenic
994318273 5:98360023-98360045 AAGAACCAGGGCAAGAAATCTGG - Intergenic
995114586 5:108465420-108465442 AAAAACATGGGTCAAAATTAGGG + Intergenic
997805194 5:136910612-136910634 AAGCACATGGGACAGACATCTGG - Intergenic
997893685 5:137696975-137696997 AGAAACAAGGGTCAGAGATCTGG - Intronic
998124941 5:139611844-139611866 AAAAACAGGGGACAGAAATCAGG - Intronic
1000938632 5:167333485-167333507 AAGAACATGGCTCACTGATCAGG - Intronic
1000984825 5:167855625-167855647 AAGAATATGTGTCAAAAATATGG + Intronic
1002345891 5:178547347-178547369 AAGAACATGGGTAAGAATATTGG + Intronic
1005488231 6:26321731-26321753 AAAAATAGGGGACAGAAATCAGG - Intergenic
1005960338 6:30689078-30689100 AGGTACATGGATCAGAAGTCAGG - Intronic
1006712424 6:36085654-36085676 AAGAACTTGGTTTATAAATCTGG - Intronic
1008326813 6:50192318-50192340 AGAAATATGGGTCAGAAATGTGG + Intergenic
1008737851 6:54569061-54569083 AAGTATATAGGTCAGAAATGAGG - Intergenic
1008744990 6:54658775-54658797 AAGTACATGGCTGGGAAATCAGG + Intergenic
1008767397 6:54935479-54935501 AAGATCCTGGGGCAGATATCTGG + Intronic
1009760295 6:67996457-67996479 AAGAATAGGGGTCAAAAATCTGG - Intergenic
1011606835 6:89114683-89114705 AAGTACATAGATCAGAGATCAGG + Intronic
1012558437 6:100546826-100546848 AAAAATAGGGGACAGAAATCAGG - Intronic
1014475196 6:121863687-121863709 AAGAACTTGCTTTAGAAATCTGG + Intergenic
1014740404 6:125142767-125142789 AAGAAATTGGGTCAGAAAACAGG + Intronic
1015133826 6:129845211-129845233 AAGAACTTGGGTCAGAATGTAGG + Intronic
1015827156 6:137326336-137326358 AATAGCATGGGTTAGAAATCAGG - Intergenic
1015951378 6:138556860-138556882 AAGAACATGAAATAGAAATCTGG + Intronic
1016056757 6:139586170-139586192 AAGAACAGGGGTGAGAAACTTGG + Intergenic
1018303906 6:162433708-162433730 AAAAACATTGTTCAGAAAACAGG - Intronic
1018533796 6:164797434-164797456 AAGAACATGTGTAAGAGATCAGG + Intergenic
1020043635 7:5023224-5023246 AAGTACATCTGTCAGAAATTAGG - Intronic
1021090239 7:16474205-16474227 AATAACTGGTGTCAGAAATCAGG - Intronic
1021396387 7:20153878-20153900 AAGAACTTGAGTCATAAAACAGG - Intronic
1023008903 7:35907658-35907680 AAGATCATGCTTCAGAAATGTGG - Intergenic
1024295731 7:47840577-47840599 AAGAACAGGGGTGGGAACTCAGG + Intronic
1024709791 7:52002680-52002702 AAGAACAACGGTCAGAGTTCAGG + Intergenic
1024981894 7:55164292-55164314 AAGAATATGAGTGAGAATTCGGG + Intronic
1027391689 7:77710163-77710185 AAGCACATGGATCTGAAATAGGG - Intronic
1028019532 7:85752503-85752525 AAGAACTTGGTTTAGGAATCTGG - Intergenic
1030651069 7:112116518-112116540 AAGAACATGTGTCACAAGTGGGG + Intronic
1031888789 7:127269843-127269865 AAGAACATGAGTCCGGAATTTGG - Intergenic
1032663161 7:134008038-134008060 AAGAACTTGGGTTAGACATCAGG - Intronic
1035123306 7:156587693-156587715 AAGAACATGGCTAGGAACTCAGG - Intergenic
1035556914 8:574005-574027 AAGTACATGGATAAGACATCAGG - Intergenic
1036913146 8:12776003-12776025 AAGAATATGTATCAGAAATTTGG + Intergenic
1042808321 8:72796124-72796146 GAGATCATGGGTCATAAATGTGG - Intronic
1043557443 8:81448397-81448419 AAGATCATGGTTCAGAACCCGGG - Intergenic
1044350025 8:91153203-91153225 AAGAACTTGCGTTACAAATCTGG - Intronic
1044829777 8:96235766-96235788 AAGAACACAGGTCAGGAATTAGG + Intergenic
1044930610 8:97248405-97248427 AAAAACATGGGCCAGGAACCAGG + Intergenic
1046021698 8:108672900-108672922 TACAACATGGGTCACAAAGCAGG + Intronic
1046183359 8:110681868-110681890 AAGGTGATGGGTCAGAAATTTGG - Intergenic
1046638711 8:116701856-116701878 AAGAACATGAGTAAGAAAACTGG + Intronic
1048447210 8:134500223-134500245 AAGGACATGGGTCAGGAAACAGG + Intronic
1048751052 8:137676246-137676268 AAGAACAAGGCTCAGGAATTAGG + Intergenic
1049993504 9:1011940-1011962 AAAAACAGGAGACAGAAATCAGG + Intergenic
1050082452 9:1929259-1929281 AATAACATGGTTCTGAAACCAGG - Intergenic
1050590313 9:7153791-7153813 AAGAACAAAGGTCAGAAAATAGG + Intergenic
1050700481 9:8333069-8333091 AATAACATCAGTCAGGAATCTGG - Intronic
1053391922 9:37741941-37741963 AAGAACATGTGACAGAGATGGGG - Intronic
1057765332 9:97911898-97911920 AATAACATGTTTCAGAAATCAGG - Intronic
1057953519 9:99388562-99388584 AAGAACTTGAGTCAGAAACATGG - Intergenic
1059949681 9:119449251-119449273 AAGAAGATGAGAGAGAAATCAGG - Intergenic
1060714929 9:125916516-125916538 GAGAATATGGGTTAAAAATCTGG + Intronic
1060966848 9:127716401-127716423 GAGAACCTGGGGCAGAAGTCAGG + Exonic
1060977024 9:127770866-127770888 AAGAGCATGGGCCAGGAAGCTGG + Intronic
1062671873 9:137715769-137715791 GAGAAAATGGGTCAGAAAAAGGG - Intronic
1185755945 X:2653079-2653101 AAAAACATCGTTCAGAACTCTGG - Intergenic
1186632992 X:11370478-11370500 AAGAACATGGGTCCTACATTAGG - Intronic
1187293894 X:17980801-17980823 AACAAAATGGTTCAGAAATCAGG + Intergenic
1187788143 X:22916911-22916933 AAGAACAGAGGTCAGAAGACTGG - Intergenic
1189212543 X:39296110-39296132 AAGAACATGGCACAGTCATCTGG + Intergenic
1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG + Intronic
1189872417 X:45397863-45397885 AAGAACATACCTCAGCAATCTGG - Intergenic
1190484001 X:50905982-50906004 AAAAATAGGGGACAGAAATCAGG + Intergenic
1190731313 X:53227765-53227787 AAGAGCATGAATCAGGAATCAGG + Intergenic
1190901144 X:54674065-54674087 TAGAACATGATTCAGAAATCAGG - Intergenic
1191176956 X:57514538-57514560 AAGAACTTGGTTTATAAATCTGG + Intergenic
1191639472 X:63414658-63414680 AAGTACATCTGTCATAAATCAGG + Intergenic
1191845490 X:65544384-65544406 GAGAACTTGGGTTGGAAATCTGG - Intergenic
1196048800 X:111283354-111283376 AAGAACATGGGTCAGAACCCTGG - Intergenic
1196056960 X:111366331-111366353 CAGATCATGTGTCAGAAAACAGG + Intronic
1196473492 X:116056122-116056144 AAGAACTTGGTTAATAAATCTGG + Intergenic
1196693175 X:118582309-118582331 CAGAACATGGATCAGAACCCAGG + Intronic
1197192009 X:123657790-123657812 AAGAATATAGGTCAGAAACTTGG + Intronic
1197861197 X:130972447-130972469 AAGATCATGGGGCTGACATCTGG - Intergenic
1198644743 X:138793731-138793753 AAAAACCTGGGTTAGAATTCTGG + Intronic
1200822221 Y:7598404-7598426 AAAAACATGGGTTAAAAGTCTGG + Intergenic
1202238080 Y:22735613-22735635 AAAAACATGGGTTAGAAGTCTGG - Intergenic