ID: 1139202478

View in Genome Browser
Species Human (GRCh38)
Location 16:64992328-64992350
Sequence GTGCATATTAAGTTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139202478 Original CRISPR GTGCATATTAAGTTTAAAGC AGG Intronic
905248884 1:36634858-36634880 TTGCATACTAATTTTATAGCTGG + Intergenic
908696290 1:66845568-66845590 GGGGATATTAAGAGTAAAGCTGG - Intronic
912125397 1:106531123-106531145 GAGCAAATTCAGTTTAAAGTAGG + Intergenic
916119962 1:161520579-161520601 GTGCATTTTAATGTAAAAGCAGG - Intronic
916129724 1:161602230-161602252 GTGCATTTTAATGTAAAAGCAGG - Intronic
921662714 1:217825709-217825731 GTACATATTTAGTCTACAGCAGG + Intronic
923143068 1:231177751-231177773 ATGCATATGATGTATAAAGCTGG - Intronic
924769382 1:247065594-247065616 GTGCAGAGTATGTTTAAAGGGGG + Intronic
1062965003 10:1600355-1600377 ATGGATATTAAGATTCAAGCAGG + Intronic
1069174196 10:65270354-65270376 CTACATTTTAAGTTAAAAGCTGG + Intergenic
1069208823 10:65730337-65730359 GTGCAGATCAAGTTCAAAGGTGG + Intergenic
1070278203 10:75028624-75028646 GTACAAATTCAGTTTAAATCCGG - Exonic
1074240064 10:111629492-111629514 TTGCATAATAAGATTAAAGTGGG - Intergenic
1075613423 10:123872450-123872472 ATGAATATTAAGTTCAAAACAGG + Intronic
1079389389 11:20008064-20008086 GTGTATTTTAAGTTTAAATCAGG + Intronic
1080427007 11:32164655-32164677 GGGCAAGTTAAGTTTAAAGCTGG - Intergenic
1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG + Intronic
1086582619 11:88416717-88416739 GCACAGATTAAGCTTAAAGCAGG - Intergenic
1087826876 11:102775210-102775232 CTGCATATGAAGTTAACAGCAGG - Exonic
1089322027 11:117632947-117632969 GTGAGTAGTAAGTTCAAAGCTGG + Intronic
1094403005 12:30082985-30083007 AGGCATCTTAAGTTTAAGGCAGG + Intergenic
1095834653 12:46624233-46624255 GTTCATATTTACTTTATAGCAGG - Intergenic
1097653173 12:62328986-62329008 TTGCATATAAAGTTGAAAGTAGG - Intronic
1100309297 12:93378728-93378750 GTGCGAATTGAGTTGAAAGCCGG + Intronic
1101693124 12:107099278-107099300 GTGAATATTATGTATAAAGGGGG + Intergenic
1104436423 12:128760503-128760525 ATGCATCTAAAGGTTAAAGCTGG - Intergenic
1105398114 13:20060348-20060370 GTGCATATTAAGTTTATATTTGG + Intronic
1106409613 13:29502243-29502265 GTACATATGCATTTTAAAGCTGG - Intronic
1106993099 13:35447693-35447715 ATGTATATTATGTGTAAAGCTGG - Intronic
1109143332 13:58744797-58744819 GAGAAATTTAAGTTTAAAGCGGG - Intergenic
1114058361 14:18996151-18996173 ATGCATATTAAGAATAAAACTGG - Intronic
1114104185 14:19405603-19405625 ATGCATATTAAGAATAAAACTGG + Intronic
1114204991 14:20561789-20561811 GTGAAAATTTAATTTAAAGCTGG - Intergenic
1116913634 14:50498709-50498731 AAGCATGTTAAGTTTACAGCTGG + Intronic
1121835114 14:97085229-97085251 GTACATATTCAGTTGATAGCAGG + Intergenic
1121940530 14:98066217-98066239 TTGGAAATTCAGTTTAAAGCAGG - Intergenic
1125173171 15:36790274-36790296 GTGCATTTAGAGTTTAGAGCTGG - Intronic
1127237141 15:57066669-57066691 ATTCATGTTAAGTTTAAAGCAGG - Intronic
1127402741 15:58606410-58606432 GTGCATATTAACTTTGAAACTGG - Intronic
1128411040 15:67397614-67397636 GTGCATCATAAACTTAAAGCTGG + Intronic
1136934342 16:34444946-34444968 GTGCATATTATCTTTAGAGATGG - Intergenic
1136970230 16:34966868-34966890 GTGCATATTATCTTTAGAGATGG + Intergenic
1139178490 16:64717742-64717764 CAGCATACTAAGTTTAAGGCTGG - Intergenic
1139202478 16:64992328-64992350 GTGCATATTAAGTTTAAAGCAGG + Intronic
1139869804 16:70097827-70097849 GTGTATACTCAGTTTATAGCAGG + Intergenic
1140385637 16:74534726-74534748 GTGTATACTCAGTTTATAGCAGG - Intronic
1144612243 17:16730994-16731016 GTGCATATTTAGAATAAAACTGG - Intronic
1144841786 17:18191092-18191114 GGGCATATTAAGTTGCAAGCTGG + Intronic
1144900487 17:18584303-18584325 GTGCATATTTAGAATAAAACTGG + Intergenic
1145131959 17:20361382-20361404 GTGCATATTTAGAATAAAACTGG - Intergenic
1147749040 17:42716459-42716481 GTGCATATTAAATATAATGCTGG - Intronic
1149934904 17:60795253-60795275 GTGTATATTAATTTTATATCCGG + Intronic
1150720472 17:67610098-67610120 GGGCATATTATGTTTGAGGCAGG - Intronic
1154179730 18:12123352-12123374 CTGCATATTAAGAGTAAAACTGG - Intronic
1155096537 18:22560900-22560922 GTAGATATTAAAGTTAAAGCAGG + Intergenic
1156774853 18:40774951-40774973 TTACATATTAAGTTTACAGTAGG - Intergenic
1157613203 18:48971666-48971688 GTTCATATACAGTTCAAAGCAGG - Intergenic
1162321745 19:9974508-9974530 GTTCAGATTAAGTTTAGAGAGGG + Intronic
925786608 2:7437191-7437213 ATGCATATTTTATTTAAAGCAGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
933976166 2:87513189-87513211 TTGCATTTTAAGCTTAAAGGGGG + Intergenic
934807195 2:97242311-97242333 CTGCATATTAAGAATAAAACTGG - Intronic
934830311 2:97514876-97514898 CTGCATATTAAGAATAAAACTGG + Intronic
935101891 2:100003861-100003883 GTCCAAATTAAGTTTAAAATTGG - Intronic
936317656 2:111437615-111437637 TTGCATTTTAAGCTTAAAGGGGG - Intergenic
938282844 2:130078066-130078088 ATGCATATTAAGAATAAAACTGG + Intronic
938432769 2:131260839-131260861 ATGCATATTAAGAATAAAACTGG - Intronic
938476774 2:131623093-131623115 ATGCATATTAAGAATAAAACTGG - Intergenic
939243776 2:139596429-139596451 GTGCATGTTAAGTATACATCTGG - Intergenic
940421866 2:153488477-153488499 GTGACTATTAAGGTTAAAGTGGG - Intergenic
943939780 2:193977879-193977901 TTCCATATAAAGTTTAAAGTAGG - Intergenic
944846120 2:203669646-203669668 GTCCATATAAAGTTCAAAACAGG - Intergenic
946783228 2:223214869-223214891 GGACTAATTAAGTTTAAAGCTGG - Intergenic
949005859 2:241647227-241647249 GTGTATCTTTAGTTCAAAGCTGG + Intronic
1170010964 20:11723618-11723640 GTGCCTATGGAGTTTAAAGGCGG - Intergenic
1171197304 20:23210032-23210054 CTGCATTTTCAGTTTCAAGCAGG + Intergenic
1171985240 20:31655863-31655885 GTGCATATTAATTAAAAATCAGG + Intergenic
1177130928 21:17254191-17254213 GTGCCTATTAAGTCCTAAGCAGG + Intergenic
1177727386 21:24987240-24987262 GTGCAGATTAAGTTAAGAGCTGG - Intergenic
1180476849 22:15718770-15718792 ATGCATATTAAGAATAAAACTGG - Intronic
1180566972 22:16678434-16678456 CTGCATATTAAGAGTAAAACTGG + Intergenic
949399302 3:3648824-3648846 TTACATATTTAGTTTAAAGTGGG + Intergenic
949454080 3:4219845-4219867 GTGCTTCTTAACTTTAAGGCTGG - Intronic
951014702 3:17717846-17717868 GTGCATAGTAAGTGTAAAGGTGG - Intronic
954435941 3:50496230-50496252 GTGCATATGAAGTCAAATGCGGG - Intronic
954514459 3:51160161-51160183 GTGCATATGCAGTTTATACCTGG + Intronic
955784567 3:62523515-62523537 CTCCATATTATGTTAAAAGCTGG + Intronic
958513423 3:95079838-95079860 TTGCACAGTAACTTTAAAGCTGG - Intergenic
958727971 3:97929211-97929233 GTCCATGTTAACTTTGAAGCTGG - Intronic
960382148 3:116976316-116976338 ATTCATATAAAGTTTAAAACAGG - Intronic
962020770 3:131499108-131499130 ATTTATATAAAGTTTAAAGCAGG - Intronic
962692992 3:137919602-137919624 GTGCATATAAATCTTAAAGAAGG + Intergenic
964679686 3:159323914-159323936 GTTCATCCTAAGTTGAAAGCAGG + Intronic
966641321 3:182193841-182193863 GTGCTCATTAGGTTTAACGCTGG + Intergenic
968413291 4:407242-407264 ATGCATATTAAGAATAAGGCGGG + Intergenic
969862306 4:10047175-10047197 GTGGATATTAAGGTAAAATCTGG - Intronic
969896886 4:10313647-10313669 GTGAATATTTAGTTGAAAGGAGG - Intergenic
971230251 4:24795692-24795714 GTGCTTATTGAGTCTGAAGCTGG + Intronic
973585789 4:52389677-52389699 TTTCATATTAATTTTAAAGTAGG + Intergenic
973942472 4:55924546-55924568 GATCAGATTAAGTTTAAACCAGG + Intergenic
976303006 4:83533485-83533507 TTGCAGATTAAGTTTAATTCAGG + Intergenic
977382347 4:96291814-96291836 CTGCATTTTAACTTTAATGCTGG + Intergenic
978965090 4:114730921-114730943 TGGTAGATTAAGTTTAAAGCAGG - Intergenic
979648225 4:123097503-123097525 AGCCATATTAAGATTAAAGCTGG + Intronic
981074885 4:140580933-140580955 GTACATATTGAGTCTAAAACAGG - Intergenic
983446246 4:167856907-167856929 GTGCATGTGAATTTTATAGCAGG - Intergenic
983771250 4:171552007-171552029 ATGTATATTAAGTTTCAACCAGG + Intergenic
990109001 5:52300015-52300037 GAGCATTTTCAGTTTAAAGGTGG + Intergenic
991211869 5:64115216-64115238 GTGCATATTAAATGTTTAGCTGG + Intergenic
995144928 5:108776958-108776980 CTGCATAGTAAGTATAAATCAGG - Intronic
1010808743 6:80271631-80271653 GTGCATCTTAAATTTTGAGCAGG - Intronic
1014883692 6:126753730-126753752 CTGCATACTAAATTTAAATCTGG + Intergenic
1015114487 6:129632757-129632779 ATGCATATTATCTTTAAGGCAGG + Intronic
1016634281 6:146269682-146269704 TTGCATATGAAGTTTACAACAGG - Intronic
1020989704 7:15181656-15181678 GTGAATATTAAAGTTAAAGAAGG - Intergenic
1021193541 7:17649389-17649411 GCTCATATTAAGTTTCAACCAGG + Intergenic
1027938977 7:84648435-84648457 GTGCACATTAAATTTTAAACAGG + Intergenic
1028074470 7:86494555-86494577 GTGCATTTTCAGTTAAATGCAGG + Intergenic
1028264594 7:88706563-88706585 GTGAATATAAAGTTAAAACCAGG + Intergenic
1029954362 7:104622007-104622029 ATGCATATTAAGTAGAAATCAGG - Intronic
1033065721 7:138152122-138152144 GTGCATATTTAACTTAAAACAGG - Intergenic
1033927234 7:146478385-146478407 GTGCTAATTAAGTTCTAAGCTGG + Intronic
1036949379 8:13126638-13126660 TTGAATAATAAGTTTAAAGAGGG - Intronic
1040087435 8:43360053-43360075 ATGCATATTAAGAATAAAACTGG - Intergenic
1043325427 8:79044822-79044844 GAGAAAATTAAGTCTAAAGCAGG + Intergenic
1045445802 8:102262380-102262402 ATGTATATTAAGTTCAGAGCCGG - Intronic
1046218001 8:111175043-111175065 GTGCATATTGTGATTATAGCAGG + Intergenic
1046958174 8:120083063-120083085 CTCCTTATTAAGTTGAAAGCAGG - Intronic
1047995953 8:130336209-130336231 GTGATTATTAAGTTCGAAGCAGG - Intronic
1050952952 9:11619558-11619580 GTGTATTTAAAGTTTAAAACAGG - Intergenic
1051766615 9:20531434-20531456 GTGAATATAAAGTTGAAAGGAGG - Intronic
1051817856 9:21130893-21130915 ATGCATATTAATTTGAATGCAGG - Intergenic
1055539528 9:77288322-77288344 GAGCATATTAAATCCAAAGCAGG - Intronic
1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG + Intergenic
1060869359 9:127027315-127027337 TTCCATATTAAGTTCAAAACAGG - Intronic
1203583081 Un_KI270746v1:32326-32348 CTGCATATTAAGAATAAAACTGG - Intergenic
1189931516 X:46016926-46016948 GTGCACATTACAATTAAAGCAGG - Intergenic
1190995295 X:55602020-55602042 TTCCATATTAAATTTAAAGTAGG + Intergenic
1194052276 X:89084755-89084777 GTTCATATAAATTTTAAAACTGG - Intergenic
1195622463 X:106970961-106970983 TTCCATATGAAGTTTAAAGTAGG - Intronic
1195799698 X:108693951-108693973 GTAAATATAAAGATTAAAGCTGG + Intronic
1196367097 X:114935393-114935415 GTGCATTTTTAGTTTTATGCAGG + Intergenic
1198021989 X:132668012-132668034 TTGCATATAAAGTTGAATGCGGG - Intronic
1200314121 X:155113651-155113673 GTGCACATAAGTTTTAAAGCTGG - Intronic
1202049979 Y:20770480-20770502 TTGCTTATTAAGTTTAATCCTGG + Intronic