ID: 1139203301

View in Genome Browser
Species Human (GRCh38)
Location 16:65001436-65001458
Sequence CAGGGTAAATAGAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139203301_1139203306 2 Left 1139203301 16:65001436-65001458 CCTTTGTTCTTCTATTTACCCTG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1139203306 16:65001461-65001483 GCACACCTGGCAGAAGTTAAGGG 0: 1
1: 0
2: 1
3: 9
4: 176
1139203301_1139203308 7 Left 1139203301 16:65001436-65001458 CCTTTGTTCTTCTATTTACCCTG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1139203308 16:65001466-65001488 CCTGGCAGAAGTTAAGGGCAAGG 0: 1
1: 0
2: 1
3: 22
4: 260
1139203301_1139203305 1 Left 1139203301 16:65001436-65001458 CCTTTGTTCTTCTATTTACCCTG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1139203305 16:65001460-65001482 TGCACACCTGGCAGAAGTTAAGG 0: 1
1: 0
2: 1
3: 6
4: 147
1139203301_1139203309 21 Left 1139203301 16:65001436-65001458 CCTTTGTTCTTCTATTTACCCTG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1139203309 16:65001480-65001502 AGGGCAAGGACATACGAATGAGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139203301 Original CRISPR CAGGGTAAATAGAAGAACAA AGG (reversed) Intronic
900337198 1:2170090-2170112 CAGGGTGAAGAGCAGAACCAGGG - Intronic
902541389 1:17157865-17157887 GATGATAAATGGAAGAACAATGG - Intergenic
902557802 1:17257259-17257281 CAGGGGAAATGGCAGAACCAGGG - Intronic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
903991623 1:27274886-27274908 CATGGTAGAGAGAAGAAGAAAGG + Intronic
904509829 1:30995165-30995187 AAAGGTGAAAAGAAGAACAAGGG - Exonic
906863501 1:49389355-49389377 CTAGGCAAATAGAAGAGCAAAGG - Intronic
907057003 1:51378844-51378866 GAGGGGAAAAAAAAGAACAATGG + Intronic
908713009 1:67039397-67039419 CAGGGTAAGTAGAACAGGAATGG - Intronic
911523989 1:98962564-98962586 CAGAGAAAATGGAAGCACAAAGG - Intronic
912467529 1:109884170-109884192 CAGGTTAAATAGCAGACCATAGG + Intergenic
912651969 1:111448357-111448379 CAGGTTACACAGAAGAAAAATGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
913299868 1:117359352-117359374 CTGGTAAAGTAGAAGAACAAAGG - Intergenic
913937192 1:125065752-125065774 CAAGGAAAATGGAAGAACACCGG + Intergenic
913978398 1:143485403-143485425 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
914072808 1:144311051-144311073 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
914106346 1:144655309-144655331 TAAAGTAAATAGAAGAAAAAAGG + Intergenic
915454326 1:156029398-156029420 CATGGTAGATAGAAGAACTTTGG + Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916718515 1:167464665-167464687 CAGGGTGAGTAGAAGAAGAGGGG + Intronic
916849808 1:168691993-168692015 AAAAGTATATAGAAGAACAAAGG + Intergenic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
917690221 1:177461170-177461192 AATTGTAACTAGAAGAACAATGG - Intergenic
918359454 1:183740979-183741001 TAGAGTACATAGAATAACAAAGG + Intronic
919107700 1:193174310-193174332 CAAGATAACTAGAAGAAAAAGGG - Intronic
919311158 1:195911479-195911501 CTGGGTAAACACAAAAACAAAGG - Intergenic
920278983 1:204829114-204829136 CGAGGTAAACAGAAGTACAAGGG - Intronic
1064877135 10:20006914-20006936 CAGAGGAAATACAAGAAGAAAGG - Intronic
1065050308 10:21785266-21785288 CTGGGGAAATTGAAGTACAAAGG - Intronic
1067255744 10:44638211-44638233 CAGGAGAAAAAGAAGAATAAAGG - Intergenic
1068470772 10:57460038-57460060 AAGAGTAAATAGATGACCAAGGG - Intergenic
1068496440 10:57789985-57790007 CAGGGTAAAGAGGAAAACAGTGG - Intergenic
1070549296 10:77478138-77478160 CAGGGTAAATATTAGAAAAATGG - Intronic
1073559710 10:104486467-104486489 CAGGGTAGATGGAAGGACAGGGG + Intergenic
1074619788 10:115106970-115106992 GAGGGTAAATAGAGGGTCAAGGG + Intronic
1074672637 10:115810963-115810985 CATGCAAAATAGAAAAACAAAGG - Intronic
1075652797 10:124140249-124140271 CAGGGTAAATAGTCAATCAATGG - Intergenic
1077733869 11:4767135-4767157 GAGAGAAAATAGAAGAAAAAAGG + Intronic
1079566802 11:21892355-21892377 CAGGGTAAAAACCAAAACAATGG - Intergenic
1079637960 11:22769053-22769075 CAGGGTTAATAGAAAAAGTATGG + Intronic
1081127653 11:39340937-39340959 CAGGGTGAATAGAGAAACACTGG - Intergenic
1082884224 11:58066715-58066737 CAGGGTCACCAGAAGAACAGAGG - Intronic
1082947826 11:58779066-58779088 CAGAGGAACTAGAAAAACAAGGG + Intergenic
1083480876 11:62945814-62945836 CAAGGTAAATAAAAGACAAAAGG - Intronic
1083924188 11:65796126-65796148 CAGGATAAATAGAAGCGCACGGG - Exonic
1085549986 11:77360126-77360148 CGGGATAAATGGAAGAACTAAGG + Intronic
1086325233 11:85692033-85692055 CAGGGTAAATGGAAGAATTTAGG + Intergenic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086599580 11:88616466-88616488 CATGGAAAATAGAACAACAGTGG + Intronic
1088067663 11:105740804-105740826 AAGTTTAAATAGAAGAAAAAGGG + Intronic
1088416490 11:109594941-109594963 TAGTGTAAAGAGAAGATCAAGGG + Intergenic
1088795842 11:113266178-113266200 CAAGATAACTAGAAGAACAAAGG - Intronic
1089074394 11:115726804-115726826 AAAGGAAAATAGAAGAACAAAGG + Intergenic
1089293450 11:117452873-117452895 CAGGGTAAATGGAAGCTCTAAGG - Intronic
1089327347 11:117666439-117666461 CAGGGATAAGACAAGAACAAAGG - Intronic
1090569701 11:128032683-128032705 CTGGGAAAATTGAAGAACAAGGG + Intergenic
1090697342 11:129261220-129261242 TAGGTTAAATAAAAGAAAAATGG + Intronic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091820879 12:3474383-3474405 AAAGGCAAATGGAAGAACAAAGG - Intronic
1091873149 12:3911954-3911976 CAGAGGAAATATAAGAACAATGG - Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1093479921 12:19593708-19593730 CAGGGGAGAGAAAAGAACAAAGG + Intronic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1094572728 12:31655561-31655583 CAGGATAGGTAGAAGAATAATGG - Intronic
1095038580 12:37419848-37419870 CAAGGAAAATGGAAGAACACCGG + Intergenic
1095838120 12:46661023-46661045 CAGGGTTAAGAAAGGAACAAAGG + Intergenic
1096443534 12:51667294-51667316 CAGGAAAAAAACAAGAACAAAGG - Intronic
1097540721 12:60938784-60938806 CAGGGTAAAAAGAGGCAAAAAGG - Intergenic
1097647265 12:62251497-62251519 CAGGGTAAAGACCAAAACAAGGG + Intronic
1098095522 12:66951368-66951390 CAGAGCAAATAGCAGCACAAAGG + Intergenic
1098978171 12:76926424-76926446 CGGGGTAAATGGAAGAAAAAGGG + Intergenic
1099884666 12:88512660-88512682 CAGGGTAAAAATAAGACAAATGG + Intronic
1101693264 12:107100959-107100981 CAGGGCCTCTAGAAGAACAATGG - Intergenic
1101779103 12:107819646-107819668 CAGCTTATACAGAAGAACAAAGG + Intergenic
1102327721 12:112002602-112002624 CACAGTAAATAGAAGAGCAGGGG - Intronic
1103423773 12:120813090-120813112 GAGGGTAAATATAAGGATAAGGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104317443 12:127717132-127717154 CAGGAAAAGAAGAAGAACAAAGG - Intergenic
1105220934 13:18325991-18326013 TAAAGTAAATAGAAGAAAAAAGG + Intergenic
1107973928 13:45671394-45671416 CAAGGATGATAGAAGAACAAAGG + Intergenic
1109277302 13:60317046-60317068 CAGTGTCTATAGAGGAACAAGGG + Intergenic
1110172264 13:72515804-72515826 CAAGGATAATAGAAGAGCAAAGG + Intergenic
1110878945 13:80546286-80546308 CAGGGAAAATATCAAAACAATGG - Intergenic
1111988255 13:95087662-95087684 CAGGATGAATAGAAGCAAAAGGG + Intronic
1112097796 13:96153467-96153489 CAGGATAAATAAAAGAACCCTGG - Intronic
1112221371 13:97494636-97494658 CAGAGTAAATAGAACATCAACGG + Intergenic
1112791533 13:103007877-103007899 TAGGGTATATAAAAGAATAAAGG - Intergenic
1112793849 13:103032835-103032857 AAGGGTAAATAGCAAAACCAAGG + Intergenic
1112969786 13:105246281-105246303 CAGGTTAAAAAGAGGAACAAAGG + Intergenic
1113228810 13:108189775-108189797 CCGGGGAAATAGAAGTGCAAAGG - Intergenic
1113668755 13:112160550-112160572 AAGGGAAAAGATAAGAACAAGGG - Intergenic
1115302464 14:31899998-31900020 CAGGGTAAATGGAATATCCATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116934101 14:50719794-50719816 CAGGGTATATAGAAAACAAAAGG + Intronic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1117067484 14:52024874-52024896 CAGGACAAGTAGAAGAAAAAAGG + Intronic
1117237279 14:53791545-53791567 CAGGATACATAGAAGACCACAGG - Intergenic
1119338884 14:73858084-73858106 AAGGGAAAAGAGTAGAACAAGGG + Intronic
1120533220 14:85659227-85659249 TAGGGATAATAGAAGAACAGAGG + Intergenic
1120634629 14:86936540-86936562 CAGGGTACAGAGAGTAACAAAGG - Intergenic
1121383850 14:93498830-93498852 CAGGGCAAAAAGGTGAACAAGGG - Intronic
1121578515 14:95008551-95008573 CAGGGTAACTACAAAACCAAGGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125532251 15:40421321-40421343 AGTGGTAAATGGAAGAACAAGGG + Intronic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125935651 15:43633275-43633297 CTGTGTTGATAGAAGAACAAGGG - Intronic
1125948420 15:43729739-43729761 CTGTGTTGATAGAAGAACAAGGG - Intergenic
1125963040 15:43848518-43848540 CAGGAAAAATAGAAGAAGTAGGG + Intronic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1128508762 15:68300591-68300613 CAGGGTAAATAGATTCAGAAAGG + Intronic
1128668294 15:69554622-69554644 CTGGGCAAATAAAAGAACAAAGG - Intergenic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1130549760 15:84882715-84882737 GAAGGTAAAAAGAACAACAAGGG + Intergenic
1133146318 16:3789375-3789397 CAGTGCAAACAGAATAACAAAGG - Intronic
1136738163 16:32482969-32482991 CAGGATAAATACAAGAAACAAGG + Intergenic
1137813395 16:51374938-51374960 CAGGGAAAGTATAAGAGCAAGGG - Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1140046405 16:71442719-71442741 GAGGGGAAATAGAAGCTCAAAGG - Intergenic
1140471385 16:75217198-75217220 CAGGGGAAAAAGAAAAAAAAAGG + Intergenic
1203014910 16_KI270728v1_random:346604-346626 CAGGATAAATACAAGAAACAAGG - Intergenic
1203033245 16_KI270728v1_random:619763-619785 CAGGATAAATACAAGAAACAAGG - Intergenic
1142911402 17:3096158-3096180 CAAGGAAAATAGAGGAAAAAAGG + Intergenic
1143071576 17:4299764-4299786 CAGGTAAAATAGAAGAAGAGGGG - Intronic
1146223323 17:31045331-31045353 CAGGATAAATAAAAGAATCATGG + Intergenic
1146341669 17:32024639-32024661 CAGGATAAATAAAAGAATCATGG - Intronic
1146351134 17:32094983-32095005 CAGGATAAATAAAAGAATCATGG + Intergenic
1148117833 17:45187832-45187854 AAGGGAAGATAGAAGAAAAAAGG - Intergenic
1148381087 17:47198502-47198524 CTGGGTAAATTGCAGAGCAATGG + Intergenic
1149267162 17:54939413-54939435 CAGGGGAAATACAATGACAAAGG + Intronic
1149311932 17:55403049-55403071 CAGGGTAATAAAAAGAGCAATGG + Intronic
1151440150 17:74123247-74123269 CATGCTAAGAAGAAGAACAAAGG - Intergenic
1152430366 17:80245489-80245511 CAGAGTAAATGGGATAACAAGGG - Intronic
1152746384 17:82041762-82041784 AAGGGCAAAAAGGAGAACAAAGG + Intergenic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1155929330 18:31689442-31689464 CAGGGTAAATAGAAGAGGCTGGG + Intergenic
1156571503 18:38258927-38258949 GTGGGTAAAAAGGAGAACAAAGG - Intergenic
1158058228 18:53307292-53307314 CAGGGGAAAAAGAAAAACATAGG - Intronic
1162429221 19:10617218-10617240 CAAGATAAGAAGAAGAACAAGGG - Intronic
1164808186 19:31133934-31133956 TAGGGGAAAAAGAAGAACCAAGG + Intergenic
1167650821 19:50727699-50727721 CTGGGTCAAGAGAGGAACAAGGG - Intergenic
925071889 2:976195-976217 CAAGGTAAATAGAAAAATTATGG + Intronic
925679787 2:6408509-6408531 CAGGTAAAATAGGAGAAGAAAGG + Intergenic
925683889 2:6451978-6452000 CAGGATAAATAGGAGGACAAAGG + Intergenic
926874591 2:17461024-17461046 CTGGGTAAATAGAATAATAGAGG - Intergenic
927560831 2:24071781-24071803 CAAGGAAAATAGAAGCACAAAGG + Intronic
928682589 2:33717554-33717576 CTTGGTAAAGGGAAGAACAAGGG + Intergenic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
933317097 2:80727947-80727969 CAACTTAAATAGAAGAACATAGG + Intergenic
934183120 2:89646468-89646490 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
934293404 2:91720654-91720676 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
937503457 2:122509428-122509450 CAGTGTACATAAAAGAACAGTGG - Intergenic
939885044 2:147672394-147672416 CATGTTAAAAAAAAGAACAAAGG + Intergenic
940383746 2:153046371-153046393 CTGGGTAGAGAGAATAACAATGG + Intergenic
941502847 2:166301826-166301848 GAGGGTAAATATAAAAAGAAGGG + Intronic
945658110 2:212650558-212650580 CAGGGTTTATAGAATAACAGAGG + Intergenic
946057012 2:216911361-216911383 CAGGGTAACATGAAGGACAAAGG - Intergenic
946647203 2:221850565-221850587 CAGGGTAGAACGAAGAGCAATGG + Intergenic
1170618268 20:17972109-17972131 CATGGTGAATAAAAGAAAAAGGG + Intronic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171748113 20:29019860-29019882 CAGAGTAAACAGAAAAACTATGG + Intergenic
1173147657 20:40538665-40538687 GAGGGTAAGTAGAAGATCATTGG + Intergenic
1174935507 20:54863859-54863881 CAGGGTAAAAAGTTGAACTATGG + Intergenic
1177495957 21:21892820-21892842 AAGGGGAAATAAAGGAACAAAGG - Intergenic
1177748134 21:25246050-25246072 CAGTGGAAATACAAAAACAATGG - Intergenic
1178169597 21:30024907-30024929 CAGGATAATTAGAAGAATCAGGG - Intergenic
1178216907 21:30609022-30609044 AAGGGATAATAGAAGAAGAATGG + Intergenic
1178967155 21:37131571-37131593 CAGGCTCACTAGAAAAACAATGG - Intronic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1181070810 22:20338105-20338127 CAGGGAAAATGGAACCACAAAGG - Intergenic
1181280129 22:21713932-21713954 CAGGCCAAACAGAAGAGCAAGGG + Intronic
1184119091 22:42438651-42438673 CAGGGTTTAGTGAAGAACAATGG + Intergenic
1184447328 22:44556626-44556648 CAGGGAAAATAGAAGAGAAAAGG - Intergenic
950921735 3:16701869-16701891 AAATGTAAATAAAAGAACAAAGG - Intergenic
951307802 3:21086898-21086920 CAGGGTAGAAAGCAGATCAAGGG + Intergenic
951427405 3:22563883-22563905 CAGGCTTAATAGAAGAACTGAGG - Intergenic
952060223 3:29499117-29499139 CAGAGTGAATAGCATAACAAAGG - Intronic
952082609 3:29778701-29778723 AAGGGGAAATTGAGGAACAAAGG - Intronic
952222529 3:31339350-31339372 AAGGACAAATAGAAGAAAAAGGG + Intergenic
952234553 3:31465258-31465280 CAGAGAAAAGAAAAGAACAAAGG + Intergenic
952310051 3:32180521-32180543 CAGAGTAAATACAATAAGAATGG + Intergenic
954369372 3:50162222-50162244 CAGGGTAGATAAAGGAACAAAGG + Intronic
954397569 3:50300987-50301009 CTGGGAAAATACAAGAACCAAGG - Exonic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955440295 3:58947788-58947810 CAGGGAGAATAGGACAACAAAGG + Intronic
957568408 3:81914440-81914462 CAGGCAAAATAGAAAAAGAAAGG + Intergenic
958020288 3:87986317-87986339 CAAAGAAAATAGAAAAACAAAGG - Intergenic
960024430 3:112991703-112991725 TAAGTTAAATAGAAGAAAAAAGG - Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
963412957 3:144955130-144955152 CAAGGAAAGTAGAGGAACAATGG + Intergenic
964858608 3:161174544-161174566 CATGATAAAATGAAGAACAAAGG - Intronic
966027015 3:175296515-175296537 CAGGGTAAAGGGAAAAACAAAGG - Intronic
966457811 3:180137515-180137537 CAAGATAAATAAAAGAAAAAAGG - Intergenic
966838859 3:184071774-184071796 CATGCTTAAAAGAAGAACAAAGG + Intergenic
968048997 3:195641311-195641333 CAGAGGAAAAAGAGGAACAAAGG - Intergenic
968305623 3:197648622-197648644 CAGAGGAAAAAGAGGAACAAAGG + Intergenic
970905352 4:21209434-21209456 CAGAATAAAAAGTAGAACAAAGG - Intronic
970956368 4:21816592-21816614 AAGGGTTAATGGGAGAACAAAGG - Intronic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
972895751 4:43617797-43617819 CAGAAAACATAGAAGAACAAGGG + Intergenic
975398038 4:73900512-73900534 CAGTGTAGATACAGGAACAAGGG + Intergenic
975458652 4:74624307-74624329 CAGTGTAAAGAACAGAACAAAGG + Intergenic
977127230 4:93185331-93185353 CAGGGTAAATAAAAGATCTTAGG - Intronic
978314779 4:107423603-107423625 CAGGGAAAATGGCAGAATAAAGG - Intergenic
979226735 4:118294703-118294725 TAGGGAGAATAGAAGAACAGGGG - Intronic
979956613 4:126960960-126960982 CAGGGGAAATGGAATAACCAGGG + Intergenic
979960582 4:127015988-127016010 CATGGTAAATAGAATGGCAATGG + Intergenic
980736930 4:136901908-136901930 CAGGGACAATATAACAACAAAGG + Intergenic
980969044 4:139552327-139552349 AAGGGGAAATATCAGAACAAGGG - Intronic
981249621 4:142584056-142584078 CAGGGCATATAGAATAAGAAGGG - Intronic
982638848 4:157931398-157931420 AAGGGTAAATATAAGCATAAGGG - Intergenic
983273201 4:165587543-165587565 AAGGCTGAATAGGAGAACAAGGG - Intergenic
984112799 4:175641313-175641335 AAGGGTAAATAGAAGCGAAATGG - Intronic
984383329 4:179023597-179023619 CAGGAGAAAGAGCAGAACAAAGG - Intergenic
985742647 5:1627814-1627836 CAGAGGAAAAAGAGGAACAAAGG + Intergenic
988738669 5:34047926-34047948 CAGGGCAAAATGAGGAACAAAGG + Intronic
990122629 5:52473952-52473974 CAAAGTAAATAGTAGAACAGAGG - Intergenic
990156137 5:52879444-52879466 CAGTGTAAATAAAAGCAAAATGG - Intronic
990365497 5:55066336-55066358 CAGGGAAAATGAAAGAACTAAGG - Intergenic
990952585 5:61312727-61312749 CAGTGTAAATGCAAGGACAAGGG - Intergenic
992048469 5:72921926-72921948 CAGGGTTAATGAAGGAACAAGGG + Intergenic
992696756 5:79296808-79296830 TAGGGTAAAAGGCAGAACAAGGG + Intronic
993951944 5:94186903-94186925 CAGTGTGTATAGAACAACAAAGG + Intronic
993964019 5:94337922-94337944 CTGGGTAGACAGAAGAACAGAGG + Intronic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
995314830 5:110757522-110757544 AAGAGTAATTAGAAGAGCAAAGG - Intronic
996354914 5:122585035-122585057 CAAGGTAGATGGAAGAACATAGG - Intergenic
996957247 5:129198776-129198798 AAAGATAAATAGAAAAACAATGG + Intergenic
996980193 5:129482326-129482348 CAAGGTATACAGAAGAAAAAAGG + Intronic
998060693 5:139116512-139116534 CTGGGTAATGAGCAGAACAAGGG + Intronic
999344463 5:150803764-150803786 GAAGGTAAATAGAAGCATAAAGG - Intergenic
999678935 5:154037219-154037241 CATGGCAGAGAGAAGAACAATGG + Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000539530 5:162523085-162523107 AAAGGGAAATAAAAGAACAAAGG - Intergenic
1000891566 5:166808425-166808447 CAAGATAAATATAAGAAGAATGG - Intergenic
1001220278 5:169894744-169894766 CATGGTAAAGATAAGAACAGTGG - Intronic
1001667382 5:173444640-173444662 CAGAGCAAATACAAGAACAGAGG + Intergenic
1001785334 5:174407688-174407710 CATGGTAAAGAGAGGAAGAAGGG - Intergenic
1005197857 6:23310006-23310028 CATGGTAAAGAGAAGAACAATGG + Intergenic
1005275361 6:24211303-24211325 GAGGGTAGAGAGGAGAACAAAGG + Intronic
1006308233 6:33238122-33238144 CAGGGGAGATAAAAGAAAAATGG + Intergenic
1007804615 6:44431350-44431372 CAGGGAAAATAGAACATCAGTGG + Intronic
1008253036 6:49264404-49264426 CAGGGGAAGTAAAAGAACATGGG + Intergenic
1009057932 6:58360670-58360692 CAGAGTGAATGGAAGAACCAGGG - Intergenic
1009232897 6:61086421-61086443 CAGAGTGAATGGAAGAACCAGGG + Intergenic
1009432534 6:63582084-63582106 CAGGGCAAAAGGAAGAACAGGGG + Exonic
1010388885 6:75313446-75313468 CAGTGTGAATGGAAGAAGAATGG - Exonic
1011031470 6:82928642-82928664 CAGAGTAGAAAGAAGCACAAGGG + Intronic
1011370289 6:86629869-86629891 CAGGGTATAAAGAAGAAAAGTGG + Intergenic
1011774712 6:90716668-90716690 CAGGGTAAATAAAATATCAGAGG + Intergenic
1011945917 6:92902996-92903018 CATGCTAAATAGAAGTACAGTGG + Intergenic
1012019487 6:93899775-93899797 TAGGATAAATAGACAAACAAAGG + Intergenic
1013695143 6:112693087-112693109 CACAGTAAATAGCAGAACAAAGG - Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1018400789 6:163416484-163416506 CAGGTTGAAGAGATGAACAATGG + Intronic
1018707257 6:166471861-166471883 CAGGGTTTAGAGGAGAACAAGGG - Intronic
1020532216 7:9353267-9353289 CAGGGTAGCTAGAAGAACTGAGG + Intergenic
1020674892 7:11170970-11170992 CAGGGGAAATAGATTAACAAAGG + Intergenic
1021159817 7:17259332-17259354 CAGGGTAAGGAGAACAAAAAAGG + Intergenic
1021876396 7:25053685-25053707 CTGGGGAAATAGCAGATCAAAGG + Intergenic
1022052413 7:26690319-26690341 CAGTGAAAGTGGAAGAACAAAGG - Exonic
1022985048 7:35645064-35645086 AAGGGGAACTAGATGAACAATGG + Intronic
1023036889 7:36139005-36139027 CAGAGTATGAAGAAGAACAAAGG + Intergenic
1023622582 7:42088103-42088125 AAGGAGAAATAGAAGAAAAATGG - Intronic
1023749440 7:43357220-43357242 CAGGGTATATAGCAAAAGAAAGG + Intronic
1024498981 7:50081227-50081249 CATGGTAAATAGAGCAATAAAGG + Intronic
1025232708 7:57213286-57213308 CAGAGAAAAAACAAGAACAAAGG - Intergenic
1025526415 7:61818128-61818150 CAGGTTAAATACAAGAAACAAGG + Intergenic
1025549804 7:62230858-62230880 CAGGTTAAATACAAGAAACAAGG + Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1028132575 7:87193554-87193576 TAGGGACATTAGAAGAACAAAGG + Intronic
1028765110 7:94546913-94546935 TAGGGCAAAAAGAAAAACAAAGG - Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029520171 7:101055294-101055316 CATGTTAAATAGAAACACAAAGG + Intronic
1029611358 7:101628150-101628172 CAGGACAAATAAAAGAAAAATGG + Intronic
1030190417 7:106805116-106805138 CAGAGAAAGTAGAAGACCAAAGG + Intergenic
1030862753 7:114657275-114657297 CAGGGTAGAAAAAAGAAAAAAGG - Intronic
1031446959 7:121866605-121866627 CAGAGTAGAGAGAATAACAAAGG + Intergenic
1033776992 7:144622265-144622287 CAAGATAAATAAAAGAAAAAGGG + Intronic
1034721555 7:153298855-153298877 CAGGATAAATAGAAGACAGAAGG - Intergenic
1034969558 7:155410613-155410635 CATGGTAATTACAAGAAGAAGGG - Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1038120166 8:24604296-24604318 GTGGGTAAATAGAATAATAATGG + Intergenic
1041922899 8:63202761-63202783 CATGCTAAAGAGTAGAACAAAGG - Intronic
1043659644 8:82722078-82722100 CAGGGGAAATAGATGCACAATGG - Intergenic
1043803077 8:84636218-84636240 CAGAGCAAATATAAGAATAATGG - Intronic
1044191733 8:89327008-89327030 CAGGGGAAATTGAAGATCAGTGG + Intergenic
1044295734 8:90525154-90525176 ATGGGAAAATAGAAGAACAAGGG - Intergenic
1044385538 8:91583874-91583896 CAGGGTAAATAACAAAATAAAGG - Intergenic
1044447335 8:92294370-92294392 TAGGGTAAATAATAGAATAAAGG - Intergenic
1044634794 8:94311549-94311571 CAGGCTCAATTTAAGAACAATGG - Intergenic
1044893885 8:96867169-96867191 TAGGGAAAATAGAAGAGCTAGGG - Intronic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1047218187 8:122896163-122896185 CAGGGAGAACAGAAGAGCAATGG - Intronic
1050060122 9:1699692-1699714 CAATGTAAAGAGAAGAAGAAAGG - Intergenic
1050119296 9:2292005-2292027 CAGGGAAAACAAAAGAACACAGG - Intergenic
1052060157 9:23950238-23950260 AGGGGTAAAAAGTAGAACAAAGG - Intergenic
1052124489 9:24758210-24758232 CAAGATAAATAGAAGCACAATGG + Intergenic
1052731699 9:32293289-32293311 CATGGCAAATAGTAGACCAAAGG - Intergenic
1056234291 9:84576343-84576365 CAGTTAAAATAGAAGAACTAAGG - Intergenic
1056562283 9:87741828-87741850 CAAGCCAAAAAGAAGAACAAAGG + Intergenic
1056706600 9:88957441-88957463 CATGCTAAAGAGCAGAACAAAGG + Intergenic
1057250014 9:93493659-93493681 CAGGGGAAATAGAATAAAACAGG + Intronic
1058182844 9:101818743-101818765 CTGGGTAAATAGCAAAATAAGGG + Intergenic
1059590003 9:115648521-115648543 GAGGGGAAATTGAACAACAATGG + Intergenic
1059678773 9:116566346-116566368 AAGGCTACATAGAAAAACAAAGG - Intronic
1060171993 9:121469421-121469443 CAGGGCAAATAGACGATGAAAGG + Intergenic
1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG + Intronic
1185461699 X:335654-335676 CAAGGAAAACAGCAGAACAAAGG + Intronic
1187800871 X:23061311-23061333 GATGGTAAATAGGAGAAGAAGGG - Intergenic
1188366260 X:29318924-29318946 CAGGGTTAATTTAAAAACAATGG - Intronic
1188467807 X:30502262-30502284 CAGGCTGATTTGAAGAACAAAGG + Intergenic
1190592370 X:52017638-52017660 CAAGGGCAAGAGAAGAACAAAGG + Intergenic
1192840631 X:74851267-74851289 AAAGGTGAATAGAAGAACAAAGG + Intronic
1193039142 X:76986546-76986568 GAGGGAAAATGGAAGAAAAATGG - Intergenic
1193540620 X:82767284-82767306 AAGGGCAAAAAGCAGAACAAAGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194135663 X:90137985-90138007 CAAGTTAAATGTAAGAACAAGGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1195837350 X:109131939-109131961 CTGGTTAGATAGATGAACAAAGG + Intergenic
1196334288 X:114512865-114512887 CTGGGTAAATAGAAGATGAGTGG + Intergenic
1197063213 X:122207470-122207492 CAGAGTAAATAGTAATACAATGG - Intergenic
1197288575 X:124626567-124626589 CAGGAGATATACAAGAACAAAGG - Intronic
1197858408 X:130944015-130944037 CAGGGTGAAAAGAACAATAAAGG - Intergenic
1198687962 X:139247899-139247921 GAAGGGAAATAGAAGAACAGGGG + Intergenic
1200481429 Y:3708066-3708088 CAAGTTAAATGTAAGAACAAGGG + Intergenic
1201783423 Y:17746754-17746776 CAAGGTAGATAAAAGCACAAAGG + Intergenic
1201818130 Y:18159233-18159255 CAAGGTAGATAAAAGCACAAAGG - Intergenic
1202051347 Y:20783931-20783953 CAGGAAAAGTGGAAGAACAAAGG + Intergenic