ID: 1139203542

View in Genome Browser
Species Human (GRCh38)
Location 16:65003992-65004014
Sequence GTCAGGGAAATGCCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139203534_1139203542 13 Left 1139203534 16:65003956-65003978 CCAAAGGAGGAGCATTCAAGTTG 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1139203542 16:65003992-65004014 GTCAGGGAAATGCCTCCAGCTGG 0: 1
1: 0
2: 0
3: 23
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139203542 Original CRISPR GTCAGGGAAATGCCTCCAGC TGG Intronic
900366456 1:2313792-2313814 CTCATGGAGATGCCCCCAGCTGG + Intergenic
900935606 1:5764605-5764627 GGCGAGGAAATGCCTCAAGCTGG - Intergenic
902372504 1:16015269-16015291 GTCAGGGGAATGGGACCAGCAGG - Exonic
903133050 1:21291441-21291463 GTGAGGGCAATGGCTCCAGATGG + Intronic
904865729 1:33577503-33577525 TTCAGGGAACTGGCACCAGCAGG + Intronic
905117709 1:35656809-35656831 GTTTGGCAAATGCCTCCAGAGGG - Intergenic
916055946 1:161069100-161069122 GACAGGGAAATGGCCCCAGAAGG - Intronic
916692002 1:167198811-167198833 GTCAGGCAGATGGCTCCAGCTGG + Intergenic
917266487 1:173226242-173226264 ATCTGGGAAATGTCTCTAGCTGG - Intergenic
918889859 1:190253072-190253094 TGCAGGGAAATGAATCCAGCTGG - Intronic
920430252 1:205914355-205914377 ATCAGGGAAATGCCTCCCTTTGG - Exonic
921523209 1:216183195-216183217 GTCAGGGAAATCCTTCAGGCTGG - Intronic
923034568 1:230276574-230276596 GTCAGGGAGACGCCTGCAGAGGG + Intronic
924266947 1:242291925-242291947 GTGAGGGAAATGCCTACTGACGG + Intronic
1062818575 10:517526-517548 GTTTGGGAAAAGCCTCCTGCTGG + Intronic
1065949383 10:30638099-30638121 GTCAGTAACATGCCTACAGCAGG + Intergenic
1066717872 10:38306571-38306593 GTGAGGGAAATGCCTACTGGTGG - Intergenic
1068820209 10:61367167-61367189 GTGAGGGAAATTACTCCATCAGG - Intergenic
1068856850 10:61806484-61806506 GTCAGAGGAATGCCTCTAGCAGG + Intergenic
1069819239 10:71217425-71217447 CTCAGGGAAATGCATGGAGCCGG - Intronic
1070495990 10:77023049-77023071 CGCAGGGAAATGCCTCTATCAGG + Intronic
1072288848 10:93943630-93943652 GACAGGGCAATGCTGCCAGCAGG + Intronic
1072718219 10:97765529-97765551 CTCAGGGAAATGACTCCAGAGGG - Intergenic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1076923404 10:133467245-133467267 ATTGGGGAAATGCCGCCAGCAGG + Intergenic
1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG + Intronic
1080101066 11:28460155-28460177 GTGAGGGAGAAGCCTCCAACTGG - Intergenic
1080877986 11:36294277-36294299 GTCAGAGGAATGCCTGCAGGAGG + Intergenic
1081657634 11:44868031-44868053 GTCATTGCAAGGCCTCCAGCTGG + Intronic
1081752358 11:45520779-45520801 GTCAGGGACAAGCCTTCATCAGG + Intergenic
1082011039 11:47449605-47449627 GTCTGGGAAAGACCTCCAGCTGG + Intergenic
1084688934 11:70713633-70713655 GGGAGGGAGATGCCTCCAGGCGG + Intronic
1084699889 11:70779740-70779762 GTTAGAGATATGCCTTCAGCAGG - Intronic
1085250456 11:75140316-75140338 GGCACGGAAATGTCTTCAGCAGG + Intronic
1086581584 11:88405977-88405999 GTCTGGGAAAAGCCTGCAGGTGG + Intergenic
1089332952 11:117702446-117702468 GTCAGGGAAAGGCTTCCTGGAGG - Intronic
1091389368 12:116673-116695 GTCAGGGAAGTGCCTCCAAGGGG - Intronic
1095431840 12:42143347-42143369 GTCAGGGTAATTCCTACATCAGG - Intronic
1096551179 12:52372797-52372819 GCCAGGGATCTGCCTGCAGCTGG + Intergenic
1098290387 12:68952255-68952277 TTCAAGGAAATGCCTCCACTGGG + Intronic
1099506878 12:83488834-83488856 ATCAGAGAAAGGACTCCAGCAGG - Intergenic
1099862533 12:88238529-88238551 GTCTGGGAAAGCCCTTCAGCAGG + Intergenic
1100290349 12:93207879-93207901 GTCAATGAAATGCATCCATCTGG + Intergenic
1101405930 12:104428853-104428875 AGCAGTGAAATGTCTCCAGCTGG + Intergenic
1103305707 12:119962440-119962462 GTCAGGAGATGGCCTCCAGCTGG - Intergenic
1103587120 12:121964044-121964066 GTCAGGGAACTGGCAGCAGCTGG + Intronic
1104126592 12:125852577-125852599 GTCAGAGGGATGCCTCCGGCTGG - Intergenic
1105899693 13:24744243-24744265 GGCAGGGAGATGCCTCCACAGGG + Intergenic
1107005331 13:35603163-35603185 GTCAGAAAAATGCCTCAAGATGG - Intronic
1112310641 13:98314781-98314803 CTCTGGGAAATGCGTCCCGCAGG - Intronic
1112743018 13:102495930-102495952 CTCATGCAAATTCCTCCAGCAGG + Intergenic
1113396617 13:109954097-109954119 GTCAGGGAATTGCCTGAACCCGG - Intergenic
1114455641 14:22851564-22851586 GTCAGGGAACTGCCCCTAGCAGG - Intergenic
1115061183 14:29192155-29192177 AGCAGGGAAATTTCTCCAGCTGG + Intergenic
1118059420 14:62118597-62118619 GTCAGGAGAAAGCCTGCAGCAGG - Intergenic
1120347884 14:83313470-83313492 GCCAGAGAAATGCCTCCAGAAGG - Intergenic
1121176628 14:91895500-91895522 GTAAAGGAAATGTCCCCAGCTGG + Intronic
1121329974 14:93043795-93043817 GTCTGGGAAGGGCCTCCTGCAGG - Intronic
1121548292 14:94779173-94779195 ATAAGTGAAATGCCTCAAGCTGG + Intergenic
1122329689 14:100904078-100904100 CTCAGGGAAATGCCCCAGGCTGG + Intergenic
1122814417 14:104305422-104305444 GTCAGTGAACTGAGTCCAGCAGG - Intergenic
1126572414 15:50166268-50166290 TTAGGGGAAATTCCTCCAGCAGG + Intronic
1127358464 15:58224366-58224388 GTCAGGGACAGGCCTCTAGCTGG - Intronic
1127555003 15:60079167-60079189 GTCAGGGATATGCCCCGAGTTGG - Intergenic
1128543977 15:68555220-68555242 GGCAGGGCCATGCCTCCATCAGG - Intergenic
1129303031 15:74637481-74637503 GCCAGGGAAATGCCTACAGGAGG - Intronic
1134507972 16:14823488-14823510 ATCAGGGAACTGCCTCCCCCAGG + Intronic
1134695674 16:16222251-16222273 GTCGGGGAACTGCCTCCCCCAGG + Intronic
1134717600 16:16364650-16364672 GCCAGGCACATGCCACCAGCCGG - Intergenic
1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG + Intergenic
1134976154 16:18572435-18572457 ATCGGGGAAATGCCTCCCCCAGG - Intergenic
1136117836 16:28106609-28106631 GTTGGGGAAATGTTTCCAGCAGG - Intronic
1139203542 16:65003992-65004014 GTCAGGGAAATGCCTCCAGCTGG + Intronic
1139289051 16:65840725-65840747 GCCAAGGAAATCCCTACAGCAGG + Intergenic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1143302335 17:5919795-5919817 GTCTGTGAAATGCCTCCACCAGG - Intronic
1144471106 17:15542273-15542295 GGCAGGAAAATCCCTGCAGCTGG + Intronic
1144925361 17:18802407-18802429 GGCAGGAAAATCCCTGCAGCTGG - Intronic
1146535884 17:33651746-33651768 GACAGGGACATGGCTACAGCTGG - Intronic
1150072982 17:62168416-62168438 GTCAGGGAACTTCCTCAGGCTGG + Intergenic
1151191189 17:72399361-72399383 CTCAGGGTAGTGACTCCAGCAGG - Intergenic
1151962875 17:77416487-77416509 GCCAGGGACATGCCGGCAGCAGG + Intronic
1152092604 17:78255442-78255464 GACAGGGCTATGTCTCCAGCCGG + Intergenic
1154490245 18:14916474-14916496 GAGAGGGAGATGCCTCCAGCTGG + Intergenic
1157316182 18:46591959-46591981 GTGAGGGAAATGACTGCAGAAGG - Intronic
1159994995 18:74955797-74955819 GTCAGGGAAAGGACTTCATCAGG + Intronic
1161261496 19:3340315-3340337 GCCAGGGAAATACCCTCAGCTGG + Intergenic
1161907634 19:7168985-7169007 GTCAGGGAAGTGCAGTCAGCAGG + Intronic
1162451346 19:10757035-10757057 GTTAGAGCAATGCCACCAGCTGG - Intronic
1166975944 19:46605099-46605121 GTCAGGGAGAGGGCTGCAGCGGG - Intronic
925743391 2:7025179-7025201 GTCAGGGACATGGCTCTTGCAGG - Intronic
928195720 2:29215290-29215312 GGCAGAGAAAAACCTCCAGCAGG - Intronic
929492607 2:42409189-42409211 GTGAGTGAAATGACTCCAGCGGG + Intronic
929576010 2:43052390-43052412 GACTGGGACATGTCTCCAGCAGG + Intergenic
933944984 2:87278456-87278478 CTCAGAGAAATGCCTCCTGAGGG + Intergenic
935237792 2:101152426-101152448 CTCAGGGAAGCGCCTCCAGAAGG + Intronic
935249847 2:101251928-101251950 GTCTGGGAAATGCCACCTGGTGG + Intronic
935402439 2:102674471-102674493 GTGAGGGAAATGGCAGCAGCAGG - Intronic
936327702 2:111520012-111520034 CACAGGCAAATGCATCCAGCAGG + Intergenic
936335222 2:111583134-111583156 CTCAGAGAAATGCCTCCTGAGGG - Intergenic
946696050 2:222360294-222360316 GTCATGCATATTCCTCCAGCAGG - Intergenic
946932787 2:224687695-224687717 GTCATGGCAATCCCTCCACCTGG - Intergenic
1173068195 20:39735293-39735315 GTAAGGGAAATGCCTGCTACAGG - Intergenic
1174867002 20:54147133-54147155 CTCAGGGAAATGCAGCAAGCAGG - Intergenic
1176411667 21:6452472-6452494 GCCAGGGAAATGCCTGCAGTGGG + Intergenic
1178875679 21:36412257-36412279 GACAGGGAAGTGCCCCAAGCTGG + Intronic
1179687161 21:43060794-43060816 GCCAGGGAAATGCCTGCAGTGGG + Intronic
1181999022 22:26904961-26904983 TTCAGGCAAGTGACTCCAGCAGG - Intergenic
1182103635 22:27673983-27674005 GGCAGGGAAGTGGTTCCAGCAGG + Intergenic
1182764122 22:32746271-32746293 GTCTGGGAAAGGGCACCAGCTGG - Intronic
1184650895 22:45919065-45919087 GTAAGGGTGAGGCCTCCAGCAGG + Intergenic
1185273084 22:49937547-49937569 GCAAGGGAAAAGCCTCCAGAGGG - Intergenic
950602330 3:14045759-14045781 TTCAGGGAAGTGCCTCTAGAAGG - Intronic
951848256 3:27108404-27108426 CTCAGGGAAGTGACTGCAGCAGG - Intergenic
951995790 3:28727051-28727073 ATCAGGGAACTGCCACCAGAGGG - Intergenic
952959084 3:38578602-38578624 GTCAGGAAGATGACTCCAGTAGG + Intronic
953747043 3:45583138-45583160 GCTAGGCACATGCCTCCAGCTGG + Intronic
954353178 3:50062541-50062563 GTGAGGGAATTGCCTACACCAGG - Intronic
954945840 3:54423745-54423767 GTCAGAGAAAAGCATCAAGCTGG - Intronic
955666622 3:61355950-61355972 GTCAGGGAAATGCCATTGGCAGG + Intergenic
957968917 3:87358381-87358403 TTCTGGGAAATGCCTCCAATTGG - Intergenic
964435170 3:156643667-156643689 GTAAAGGAGATGCCTCCAGCCGG - Intergenic
965878310 3:173355525-173355547 GGAAGGGAAATTCCTCAAGCTGG - Intergenic
969701771 4:8771536-8771558 GGCAGGGAAGTGCTCCCAGCCGG - Intergenic
970991231 4:22215790-22215812 GTCAGGGAAATTCCTCCCAGAGG + Intergenic
971044696 4:22792346-22792368 GACAGGGAAATCCATCCAACTGG + Intergenic
975473216 4:74794048-74794070 GTCTAGGGACTGCCTCCAGCAGG + Intronic
981320306 4:143384528-143384550 GTCAGGGAAATGGAGCCAGATGG + Intronic
986763575 5:10902301-10902323 GTCAGGGAACTGAGTCCAGTGGG - Intergenic
988387418 5:30583232-30583254 TTCATGGAAATGTTTCCAGCTGG + Intergenic
988448165 5:31311012-31311034 GTTAGGGAAATTTCTGCAGCAGG + Intronic
990961396 5:61397374-61397396 GTCAGTGAAGTGCCCCCAGGGGG + Intronic
991580362 5:68148464-68148486 GTGAGGGAGATGCCTCCAAAAGG - Intergenic
992479236 5:77134205-77134227 TTCAGAGCATTGCCTCCAGCTGG - Intergenic
995425888 5:112022438-112022460 GTCAGGAAAATGCCTCCCCCAGG + Intergenic
995947385 5:117665091-117665113 GTCAAGGAAATCTCTCAAGCAGG - Intergenic
998822966 5:146073415-146073437 GACACGGACATGCTTCCAGCTGG + Intronic
998884089 5:146676057-146676079 GTCAGGGCATGGCCTCCACCGGG - Intronic
1001426181 5:171624042-171624064 GCCAGGGGAATGCCTCCAAACGG - Intergenic
1001963330 5:175893832-175893854 CTCTAGGAAATGCCCCCAGCAGG - Intergenic
1002051268 5:176572978-176573000 GTCAAGGAAGTGACTGCAGCGGG + Intronic
1006824904 6:36927814-36927836 GACAGGGAAATGCCTGCTGCTGG - Intronic
1007623046 6:43226415-43226437 GTCAAGGACATGCCTCATGCTGG + Intronic
1008054828 6:46935716-46935738 GTCAGGGAGATGTTTCCAGATGG - Intronic
1008864091 6:56188876-56188898 GTCAGGAAACTGTCTGCAGCAGG - Intronic
1011774113 6:90708889-90708911 GACAGGGAAAGGCATTCAGCAGG + Intergenic
1013421415 6:109970543-109970565 GCCAGGCAAATGCCTCCAGTAGG - Intergenic
1015186762 6:130426163-130426185 GACAGGGAAAAGCCACCAGTAGG + Intronic
1018301108 6:162403840-162403862 TTCAGGGAAATGGGTCCAGGTGG + Intronic
1018895726 6:168015562-168015584 TTCAGGGAAGTGGCTCCAGATGG + Intronic
1019451433 7:1100687-1100709 GTCTGTGAAATGTCCCCAGCCGG + Intronic
1021769026 7:23980151-23980173 GTCTGGAAAAGCCCTCCAGCAGG + Intergenic
1022949502 7:35322480-35322502 GTCAGTAAAGTGTCTCCAGCTGG + Intergenic
1024226899 7:47332305-47332327 ACCAGGTAAATGCTTCCAGCAGG + Intronic
1024394562 7:48850679-48850701 GTCAGAGAAGTGCTTTCAGCTGG - Intergenic
1024400698 7:48921962-48921984 GTCAGAGAAGTGCTTTCAGCTGG + Intergenic
1026165666 7:67907003-67907025 GTCAGTTAAATGCCACCACCAGG - Intergenic
1027386635 7:77665560-77665582 AGCTGGGAAATGTCTCCAGCTGG + Intergenic
1027744072 7:82051251-82051273 TTTAGGGAAAAGCTTCCAGCTGG + Intronic
1029521819 7:101067616-101067638 GCATGGGAAATGCCTCCACCTGG - Intergenic
1034844163 7:154429234-154429256 TTCTGGGAAATCCATCCAGCTGG + Intronic
1035335233 7:158123803-158123825 GATCGGGAAGTGCCTCCAGCAGG + Intronic
1036434938 8:8724212-8724234 GTTTGGCAAATGCCTCCAGATGG - Intergenic
1038032419 8:23654217-23654239 GTCAGAGAAATGCTGCCTGCTGG - Intergenic
1040378272 8:46847563-46847585 GTCAGGGCCATGCCTCAAGGAGG + Intergenic
1041319792 8:56601416-56601438 GTGAGGGAAATGCCATCAGCAGG + Intergenic
1042711960 8:71727248-71727270 GGAAGGGAAATGCCTCTACCTGG + Intergenic
1043616374 8:82130314-82130336 GTCAGGGAAATACCATCAGATGG - Intergenic
1043872922 8:85455035-85455057 TTCAGGGTAATGCTTTCAGCTGG + Intergenic
1046801476 8:118433095-118433117 GTCAGGGAAGTCCCTCCACAAGG - Intronic
1047212532 8:122851435-122851457 GTCAGGGAAGGGCCTCCTGCAGG - Intronic
1055098245 9:72436673-72436695 GTCAGTCAAGTGCCTCCACCTGG - Intergenic
1056326033 9:85479727-85479749 GGAAGGCAAATGCATCCAGCTGG - Intergenic
1059940027 9:119349742-119349764 GTCAGCGAAAAGCCCCCAGCAGG + Intronic
1062027587 9:134347629-134347651 GTTAGGGAAAGCCCTCCAGGGGG + Intronic
1062392489 9:136339539-136339561 GACAGGATAATGCCCCCAGCTGG - Intronic
1062706746 9:137949708-137949730 GTAAGGGAAAAGTCTCCAGCAGG - Intronic
1187825717 X:23332895-23332917 GTTAGGGAAATGCCTCCCCGAGG + Intergenic
1188895823 X:35667422-35667444 CTCAGGTAAATTCCTCCAGAAGG + Intergenic
1189252216 X:39610101-39610123 GTCTGGGCACTGCGTCCAGCTGG + Intergenic
1190705092 X:53020852-53020874 GTCAGGGAACTCACTCCAGCAGG + Intergenic
1195129475 X:101839387-101839409 GTGAGGGAAAGGGCTGCAGCAGG - Intronic
1195176763 X:102320442-102320464 GTGAGGGAAAGGGCTGCAGCAGG + Intronic
1195182101 X:102366651-102366673 GTGAGGGAAAGGGCTGCAGCAGG - Intronic
1195254823 X:103081169-103081191 GTGAGGGAAAGGGCTGCAGCAGG - Intronic
1196016541 X:110945394-110945416 GTGATGGAAATCCCCCCAGCTGG + Intronic
1198280947 X:135141897-135141919 CTCAGAGAAATGACACCAGCTGG + Intergenic
1198290011 X:135230619-135230641 CTCAGAGAAATGACACCAGCTGG - Intergenic
1200154734 X:153969435-153969457 GTGAGGGAAAAGCCCCCTGCAGG - Intronic