ID: 1139207818

View in Genome Browser
Species Human (GRCh38)
Location 16:65046220-65046242
Sequence CTGTCTATATGGCTGGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139207815_1139207818 15 Left 1139207815 16:65046182-65046204 CCGTGTTGACTCTGACAAGCTGA 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 135
1139207814_1139207818 26 Left 1139207814 16:65046171-65046193 CCTTTGAGATGCCGTGTTGACTC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 135
1139207813_1139207818 30 Left 1139207813 16:65046167-65046189 CCAGCCTTTGAGATGCCGTGTTG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139207818 Original CRISPR CTGTCTATATGGCTGGTTGT CGG Intronic
901415401 1:9112778-9112800 CTGGCTGTGTGGCTGGCTGTGGG - Intronic
904351719 1:29912068-29912090 CTGTCTATCTCTCTGGTTCTAGG + Intergenic
912603945 1:110968523-110968545 CTGTGTTTCTTGCTGGTTGTTGG + Intergenic
912914296 1:113796961-113796983 CTGTTTATATGCCAGGTTTTTGG - Intronic
915167472 1:153956434-153956456 CTGTTTATTTGGCTGGTCGCAGG - Intronic
915814035 1:158948277-158948299 CCTTCCATATGGCTGTTTGTTGG + Intronic
917083334 1:171279641-171279663 GGGTCTAGATGGCTTGTTGTGGG - Intronic
917185737 1:172353085-172353107 CTGTGGATATGGCTGCTTGGTGG - Intronic
918593698 1:186268800-186268822 CTGTCTTTACTGCTGGTTGCGGG - Intergenic
924652596 1:245943512-245943534 CTGTCAATATGTCTGGTCCTAGG - Intronic
1063064554 10:2595044-2595066 CTGTGTCTGAGGCTGGTTGTGGG - Intergenic
1063827517 10:9914603-9914625 ATGTCACTATGGCTGGTAGTTGG - Intergenic
1067096116 10:43301423-43301445 CTTTCCATATGGCTGTTTGTTGG + Intergenic
1069172231 10:65246590-65246612 CACTCTATATGACTGTTTGTGGG + Intergenic
1072574302 10:96686265-96686287 CTGTTTAGTTGGCTGGCTGTTGG - Intronic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1078257181 11:9668291-9668313 TTGTCTTTATGGCTGCTTATAGG + Intronic
1079180971 11:18193194-18193216 CTGCCTATGTGGCTGTGTGTTGG - Intronic
1079392113 11:20031574-20031596 CTTTCAGTATGGCTGGATGTGGG + Intronic
1079589293 11:22162991-22163013 TTGTCTACATGGCTGGCTGGGGG - Intergenic
1083811874 11:65110908-65110930 CTGTCTCTAGGGCTGTTTTTAGG + Intronic
1086200934 11:84201557-84201579 CTGTTTATATGTCTGGTTCTGGG + Intronic
1086902905 11:92387581-92387603 GTGTCTGTGTGGCTGGATGTAGG + Intronic
1087429916 11:98040567-98040589 GTGTGTATGTGGGTGGTTGTGGG - Intergenic
1088708798 11:112487624-112487646 CCATCTAGATGGCTGGGTGTGGG + Intergenic
1092774928 12:11935290-11935312 CTCTCTATATGTCTGTTTCTGGG - Intergenic
1098139115 12:67433484-67433506 TTGTCTATATGTTTGGTTCTGGG - Intergenic
1098621761 12:72609777-72609799 CTTCCTATATGGCTGATTTTTGG - Intronic
1100980714 12:100160097-100160119 CCTTCCATATGGCTGTTTGTTGG + Intergenic
1105614993 13:22003643-22003665 CAGTCTCTATGACTGTTTGTTGG + Intergenic
1107746409 13:43514935-43514957 CTTTCTATATGCCAGATTGTAGG + Intronic
1109785655 13:67171436-67171458 CTGTCAATATTGCTGCTAGTTGG + Intronic
1110625548 13:77651637-77651659 CTGGCGATATGGCTGGTTCTTGG + Intergenic
1118769791 14:68934997-68935019 CTGTAAATGTGGTTGGTTGTGGG + Intronic
1118943475 14:70360327-70360349 CAGTCTTTATGGCTATTTGTGGG + Intronic
1119543579 14:75456374-75456396 CTGTCTGTCTGCCTGTTTGTCGG + Intronic
1120016091 14:79475131-79475153 CTGTTTATATTTCTGGTTTTAGG - Intronic
1121494507 14:94382839-94382861 CTGGCTGTCTGGCTGGTTGAGGG + Exonic
1125730607 15:41890810-41890832 CTGTCCAAATGGCAGGATGTAGG - Intronic
1126470396 15:49004050-49004072 CTGTGAATATGTCTGGTTCTAGG + Intronic
1127325666 15:57892682-57892704 CTGGCTATATGCCTGGTACTGGG - Intergenic
1128054443 15:64689275-64689297 GTATTTATATTGCTGGTTGTAGG - Intronic
1129754198 15:78086433-78086455 CTTTCTACATGGCTGCTGGTTGG - Intronic
1130374757 15:83318872-83318894 CTCTCCATATGGCTGCTTGAGGG - Intergenic
1132248264 15:100314772-100314794 CTGTCTTTGTGGCTGGCTGCAGG - Intronic
1134437813 16:14277677-14277699 CTGTCTTTGTAGCTGTTTGTTGG - Intergenic
1137066927 16:35856489-35856511 CTTTCCATATGGCTGTTTGTTGG - Intergenic
1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG + Intronic
1140913617 16:79475548-79475570 CTGTCTATATGGCTCTGAGTAGG + Intergenic
1142126359 16:88412541-88412563 CTGGCTCTATGGCTGGGTCTGGG - Intergenic
1143893025 17:10116828-10116850 CTGTCTGTCTGGCTTGTTGTGGG - Intronic
1148353650 17:46959195-46959217 CTGTCCATCTGTCTGGTGGTAGG - Intronic
1151875165 17:76863917-76863939 CTCTGCATTTGGCTGGTTGTGGG - Intergenic
1151875342 17:76864921-76864943 CTCTGCATTTGGCTGGTTGTGGG + Intergenic
1154974171 18:21440987-21441009 CTGTCACTATGGTTGCTTGTAGG + Intronic
1155102797 18:22629498-22629520 CTGTCTGTCTGGCTGGATGCAGG - Intergenic
1159667049 18:71174077-71174099 GTGTTTCTATGGCTGGTTCTGGG + Intergenic
1159754721 18:72350146-72350168 CTGTCTATATAGGAGGTTTTAGG - Intergenic
1164293354 19:23887336-23887358 CCTTCCATATGGCTGCTTGTTGG - Intergenic
1167709236 19:51099804-51099826 CTGTTAATATGTTTGGTTGTAGG + Intronic
1168540694 19:57207232-57207254 CTGTCTACTTGGCTGGATGCAGG - Intronic
926877458 2:17497406-17497428 CTATGTATAAGACTGGTTGTAGG - Intergenic
929254409 2:39793876-39793898 CTGTTTGTATTCCTGGTTGTGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
936963424 2:118100704-118100726 CTGACAATATGTCTGGTTCTTGG - Intronic
937882575 2:126879555-126879577 GTGTCTATGTGTGTGGTTGTAGG - Intergenic
938405164 2:131028445-131028467 CTGCCCAGATGGCTGGTTGGGGG - Intronic
941844400 2:170119046-170119068 CCTTCCATATGGCTGTTTGTTGG - Intergenic
942093783 2:172519021-172519043 CCTTCTATATGGGTGTTTGTTGG - Intergenic
943174685 2:184456237-184456259 CTCTCTAGATTTCTGGTTGTAGG - Intergenic
943457957 2:188130798-188130820 CAGTCTATATGACTAGCTGTTGG + Intergenic
945507972 2:210664903-210664925 GTGTCCAAATGGCTTGTTGTAGG + Intronic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
947555733 2:231091691-231091713 CCTTCCATATGGCTGTTTGTTGG + Intronic
1176235563 20:64051993-64052015 CTGTCTGTCTGCCTGGGTGTGGG + Intronic
1176369486 21:6053762-6053784 ATGCCTATATGGCTGATTGCAGG + Intergenic
1179602482 21:42489397-42489419 CTGTTTGATTGGCTGGTTGTGGG + Intronic
1179754033 21:43484779-43484801 ATGCCTATATGGCTGATTGCAGG - Intergenic
949374376 3:3371712-3371734 CAGCCTATATGGCTGGCAGTAGG - Intergenic
950540984 3:13612735-13612757 ATGTCTTTTTGGGTGGTTGTGGG + Intronic
959023979 3:101219606-101219628 CTCTCAATGTGGCTGGTTCTGGG - Intergenic
965153335 3:165011567-165011589 ATGTATATATGGCTGCTTTTGGG + Intronic
965319695 3:167237657-167237679 CTTTCTATATGAGTGGTTATTGG + Intergenic
968400419 4:290689-290711 TAATCTATATGGCAGGTTGTAGG - Intronic
970148121 4:13058445-13058467 CTATCTATATGGTTGGTTTGGGG + Intergenic
970742249 4:19251805-19251827 CTGGCTGTATAGCTGGTGGTGGG + Intergenic
972655897 4:41063531-41063553 CTGGCTTTAATGCTGGTTGTTGG + Intronic
973010547 4:45067578-45067600 CTATCTAGATTTCTGGTTGTGGG + Intergenic
973035002 4:45395294-45395316 CTGTCTATATGGCTTGTAGATGG + Intergenic
977658260 4:99549953-99549975 CTTTCTATATAGCAGGTTCTAGG - Intronic
980525912 4:133991225-133991247 CCTTCCATATGGCTGTTTGTTGG + Intergenic
982669037 4:158298286-158298308 CCTTCCATATGGCTGTTTGTTGG - Intergenic
985359237 4:189155071-189155093 CTTTCTATGTGGCTGCTTGTAGG - Intergenic
989028613 5:37093517-37093539 CCTTCCATATGGCTGTTTGTTGG - Intergenic
989057503 5:37379331-37379353 CTGTCCCTGTGGCTGGTTCTGGG + Exonic
990057375 5:51600360-51600382 CTGCATATATTGCTGCTTGTTGG + Intergenic
991268605 5:64751840-64751862 CTGTTTATATGTCTGTTTATTGG - Intronic
994295997 5:98089283-98089305 TTGTCCAAATGCCTGGTTGTTGG - Intergenic
994296013 5:98089392-98089414 TTGTCCAAATGCCTGGTTGTTGG + Intergenic
994755134 5:103786002-103786024 TTGTCTGTATGGATGGATGTAGG + Intergenic
994883916 5:105533239-105533261 TTGTCTATATGTGTGGATGTAGG + Intergenic
995081888 5:108060943-108060965 CTGGCAAGATGTCTGGTTGTTGG - Intronic
997028839 5:130098380-130098402 CTGTCTAGTTGGGTGTTTGTGGG + Intronic
997744113 5:136283797-136283819 CTGTCTACATGGGTCTTTGTTGG - Intronic
999354671 5:150914952-150914974 CCTTCCATATGGCTGTTTGTTGG + Intergenic
999948524 5:156623831-156623853 CTGTCTAGCTGACTGGTTATTGG + Intronic
1000653512 5:163847725-163847747 TTTTCTATATGGATGGATGTAGG + Intergenic
1002159461 5:177306672-177306694 CTGTCTACGTGGTGGGTTGTGGG + Exonic
1004492856 6:16133173-16133195 CAGTCTGGATGGCTGGTAGTTGG - Intronic
1004578172 6:16920114-16920136 CTATATTTAAGGCTGGTTGTGGG + Intergenic
1005186474 6:23167961-23167983 CCTTCCATATGGCTGATTGTTGG - Intergenic
1006281364 6:33056299-33056321 CCTTCCATATGGCTGTTTGTTGG - Intergenic
1010216695 6:73409053-73409075 CTGTCTACATGGATTTTTGTTGG - Intronic
1010626342 6:78139980-78140002 CCTTCTATATGGCTGTTTGTTGG - Intergenic
1011618268 6:89217871-89217893 CTGTCTATATGGCTGAGATTGGG + Intronic
1015595626 6:134863837-134863859 CTGTCTATATTGCTGGTGGGTGG - Intergenic
1015597243 6:134877504-134877526 CTGCCTATTTGGCTGGTAGATGG + Intergenic
1015994749 6:138987185-138987207 CTCTCTATATGCCAGGTTCTAGG + Intronic
1017551001 6:155507411-155507433 ATGTATATATGGCTGGGCGTGGG + Intergenic
1022424627 7:30256595-30256617 CTGTCTTCATGGCTGTTTATAGG + Intergenic
1024461818 7:49667276-49667298 CTGTCTGTATGGCTGGCTTGTGG - Intergenic
1028020480 7:85765356-85765378 CCTTCCATATGGCTGTTTGTTGG - Intergenic
1028383225 7:90222616-90222638 CTGTCTCTTAGGGTGGTTGTGGG + Intronic
1028680926 7:93530784-93530806 CTTTCAAAATGGCTGGTTGTTGG + Intronic
1028908623 7:96182926-96182948 CTGTCCATATGGGTGGTTTTTGG - Intronic
1030246679 7:107390630-107390652 CCTTCCATATGGCTGTTTGTTGG - Intronic
1031156917 7:118121115-118121137 CTTTCCATATGGCTGTTTGTTGG - Intergenic
1031311158 7:120198957-120198979 ATGTATATATGTGTGGTTGTGGG - Intergenic
1033013286 7:137644950-137644972 CTGTCATCATGGCTGGTTATAGG - Intronic
1034393929 7:150805654-150805676 CTGAGTATGTGGGTGGTTGTGGG - Intergenic
1041035917 8:53790419-53790441 CTGTATAAAGGGCTGGTCGTGGG - Intronic
1041131752 8:54709233-54709255 CTGTCAACAAGGCTGGTTCTTGG - Intergenic
1044457720 8:92407447-92407469 CTGTCTGTAGGGATGCTTGTTGG + Intergenic
1045316550 8:101048489-101048511 CTGTCTCTGTGGCTGGCGGTTGG + Intergenic
1045838447 8:106551252-106551274 AGCCCTATATGGCTGGTTGTTGG - Intronic
1047163220 8:122405245-122405267 CTGTCTTTCTAGCTGGTGGTTGG + Intergenic
1051518164 9:17953939-17953961 GGGTCCATATGTCTGGTTGTTGG + Intergenic
1051862008 9:21636552-21636574 TTGTATAAATGGCTGGTTCTAGG + Intergenic
1052897297 9:33759681-33759703 CTGTCTATTCAGCAGGTTGTTGG + Intronic
1058794077 9:108480552-108480574 CTGTTTATCTGGCTGGGTGCAGG + Intergenic
1060124530 9:121029866-121029888 CTGTCCATATGTCTGGCAGTTGG - Intronic
1060719252 9:125963982-125964004 CTTTTTATATGGTTTGTTGTGGG - Intronic
1062335376 9:136063101-136063123 CTGTTTCTGTGTCTGGTTGTGGG + Intronic
1188085900 X:25900445-25900467 CCTTCCATATGGCTGTTTGTTGG - Intergenic
1188912470 X:35866474-35866496 CAGGTTTTATGGCTGGTTGTAGG - Intergenic
1190624031 X:52318982-52319004 TTGTTTATCTGGCTGGTTTTAGG + Intergenic
1191634201 X:63358711-63358733 CCTTCCATATGGCTGTTTGTTGG + Intergenic
1201520574 Y:14869262-14869284 CCTTCCATATGGCTGTTTGTTGG + Intergenic
1201977984 Y:19872911-19872933 CTTTCCATATGGCTGTTTGTTGG - Intergenic