ID: 1139208243

View in Genome Browser
Species Human (GRCh38)
Location 16:65050322-65050344
Sequence GGCTTTAAACAAATGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139208243_1139208246 3 Left 1139208243 16:65050322-65050344 CCATGCCACATTTGTTTAAAGCC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1139208246 16:65050348-65050370 CTCCGTCTTTCCTTCCCACTTGG 0: 1
1: 0
2: 1
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139208243 Original CRISPR GGCTTTAAACAAATGTGGCA TGG (reversed) Intronic
901270291 1:7947632-7947654 GGCTTTTAAAATATTTGGCAGGG - Intergenic
904324359 1:29718324-29718346 GACTTTACACAGATGTGGAATGG + Intergenic
905731135 1:40300229-40300251 GCCTTTGTACAACTGTGGCAAGG - Intergenic
907869681 1:58432016-58432038 GGTTTGGAACAAATGTGGAAGGG + Intronic
908165581 1:61454471-61454493 GGCTCTAAATAAATGCTGCATGG + Intronic
910456504 1:87403242-87403264 AGCTTTATACAAATGTAGAAAGG + Intergenic
912011001 1:104962803-104962825 GAATTTAAACAAATGTGCCGAGG + Intergenic
914219451 1:145666055-145666077 GACTTTAAACAACAGTGTCAAGG + Intronic
914472035 1:147988925-147988947 GACTTTAAACAACAGTGTCAAGG + Intronic
917089813 1:171341691-171341713 GGCTTTTAAATAATGTGACATGG - Exonic
918256998 1:182757807-182757829 GGCTTAAAACCACTGTGTCATGG + Intergenic
919669382 1:200325083-200325105 TGTTTTAAAAAAATGTGGCCAGG + Intergenic
920284525 1:204870224-204870246 GGCTGTAATCAAATGTGTAATGG + Intronic
920607872 1:207407673-207407695 GGCAATAAACAAATGTGGGCTGG + Intergenic
920754671 1:208717707-208717729 GGGCTTTAAAAAATGTGGCAGGG + Intergenic
923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG + Intergenic
924240833 1:242038712-242038734 GGCTGGACACAAATGTGGCAGGG - Intergenic
1063108031 10:3010853-3010875 TGCATGAAACACATGTGGCAAGG - Intergenic
1063483541 10:6398157-6398179 GACTTTCAACAAAGGTGCCAAGG - Intergenic
1064184004 10:13144500-13144522 GGCTTTCAACAAATATTGTAAGG + Intergenic
1064468591 10:15612126-15612148 GGTTTTAACCAAATGTGCCCAGG + Intronic
1068204113 10:53826364-53826386 GGTTTTAAACAAATGTGTTCAGG - Intronic
1068585178 10:58790519-58790541 GGTTTTAAACAAATATGGGAAGG - Intronic
1073445025 10:103575422-103575444 GGCTTCAGACAAAGGGGGCAGGG - Intronic
1075158257 10:119999502-119999524 GGGTTTCAACAAAGGTGCCAGGG - Intergenic
1077666732 11:4117025-4117047 GGCTATAAACAAATAATGCATGG + Intronic
1078229294 11:9424950-9424972 GGCTGTAAACAAAAGTGTCTGGG - Exonic
1079092131 11:17488490-17488512 GGCTTTTAACACATCAGGCAGGG + Intergenic
1079364614 11:19798468-19798490 GGCTTTAAAAAGATGTGGGGAGG + Intronic
1080260443 11:30343816-30343838 TCCTTTAGACAAATGTAGCATGG + Intergenic
1081259628 11:40943794-40943816 GGTTTTAAACATCTGTGTCATGG - Intronic
1081411753 11:42767060-42767082 GACTACAAACAGATGTGGCATGG - Intergenic
1081668706 11:44931524-44931546 AGCTTTCTACAAATGTGCCAAGG + Exonic
1085466350 11:76726218-76726240 GGCTTGACAGAAATGTGGAATGG - Intergenic
1085685098 11:78614511-78614533 AGCTTTGAACAAAAATGGCAAGG - Intergenic
1087794965 11:102446144-102446166 GGATGTAAGGAAATGTGGCATGG - Intronic
1088680382 11:112236501-112236523 GCATTAAAAAAAATGTGGCAGGG - Intronic
1091172789 11:133533025-133533047 GGTTTTAAACCAATGATGCAGGG + Intergenic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1093018940 12:14185438-14185460 GGCTATTGACAAATGTGGAAGGG + Intergenic
1096108978 12:49018070-49018092 GGCATTGACCAATTGTGGCAGGG - Intronic
1098088168 12:66870858-66870880 GGCCATAAAGCAATGTGGCAGGG - Intergenic
1098338934 12:69431975-69431997 GGCTCCAAACAAACGTGGCTAGG - Intergenic
1105825943 13:24123599-24123621 GGCTGTAAACAAAAGTGTCTGGG + Intronic
1106028751 13:25979330-25979352 GGGTTTAAAAAAACCTGGCATGG + Intronic
1106562204 13:30856687-30856709 GGCTTTGCACAAATGCAGCAAGG - Intergenic
1110936277 13:81293557-81293579 GTTTTTAAAGAAATCTGGCAGGG - Intergenic
1111588493 13:90312209-90312231 GGCTTTAAAGAATTGATGCAAGG - Intergenic
1116365879 14:44062557-44062579 GACATCAAACAAATGTGGGAGGG + Intergenic
1119197729 14:72729853-72729875 GGGTTTGAACAAATGTGTAATGG - Intronic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1122219752 14:100229967-100229989 GGCTTTAAGCAAACATGGTATGG - Intergenic
1124873732 15:33570359-33570381 GGCTTTTGACAAAGGTGCCAAGG - Intronic
1125590486 15:40851723-40851745 GGCTTAAAACAAATTTGGCCAGG + Intronic
1127636587 15:60876511-60876533 GGTTTTAAAAAAATGTGTGAAGG - Intronic
1128954735 15:71927895-71927917 GACTTTAAACAAAGGTGCCAAGG - Intronic
1130963416 15:88680306-88680328 TTCTTCAAACAAATGAGGCAAGG - Intergenic
1133150516 16:3825353-3825375 GGCTTTCAAAAAATGGCGCATGG - Intronic
1137460109 16:48653139-48653161 GACTTTTAACAAAGGTGCCAAGG - Intergenic
1137811951 16:51360765-51360787 GGCATGAAACAAACGTGGCCAGG - Intergenic
1138171664 16:54855976-54855998 AGGTATAAACAAATATGGCAGGG - Intergenic
1138287615 16:55822263-55822285 AGCTTTATATAAAAGTGGCAGGG + Intronic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1139906871 16:70372200-70372222 GGCTTTAAAAAAGTGGGGAAAGG - Exonic
1140710129 16:77670058-77670080 GGCTTTAATCAAATGTTAAATGG - Intergenic
1142879736 17:2875037-2875059 TGCTTTTAACAAATGTCGAAGGG - Intronic
1145240247 17:21236766-21236788 GGCTGGAAAAAAATGGGGCAGGG + Intergenic
1150169613 17:62979607-62979629 TACTTTTAAAAAATGTGGCAAGG + Intergenic
1150591082 17:66563241-66563263 GGGTTTGGACAAATGTGTCATGG + Intronic
1153516980 18:5912889-5912911 GGTTTAAAATAAATGTGGAAGGG - Intergenic
1154139563 18:11811112-11811134 GGCTTTTGGGAAATGTGGCAAGG - Intronic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1157757659 18:50232774-50232796 GGAGATAAACAAAAGTGGCAGGG + Intronic
1159299992 18:66550839-66550861 GGCTTAAAACAAATGTATTATGG - Intronic
1159976718 18:74722396-74722418 GGCTAGCAAGAAATGTGGCAAGG - Intronic
1160949934 19:1661287-1661309 AGCTTCAACCAAAAGTGGCATGG - Intergenic
1165230296 19:34382570-34382592 GGCTTCTAATAAATGTTGCATGG + Intronic
927708763 2:25312659-25312681 CTCTTGAAACAAATGGGGCAGGG - Intronic
931632691 2:64315651-64315673 GGCTTCCACCAAATGTGGGATGG - Intergenic
932971504 2:76548828-76548850 GGTTTTATACATAGGTGGCATGG + Intergenic
933916166 2:86996022-86996044 GGCTTTAAAATAATCTGACAAGG - Intronic
934006827 2:87773880-87773902 GGCTTTAAAATAATCTGACAAGG + Intronic
935756358 2:106278881-106278903 GGATTCAAAGAAAAGTGGCAAGG - Intergenic
935770474 2:106414802-106414824 GGCTTTAAAATAATCTGACAAGG + Intronic
935909614 2:107881134-107881156 GGCTTTAAAATAATCTGACAAGG - Intronic
936131394 2:109846261-109846283 GGCTTTAAAATAATCTGACAAGG - Intronic
936213303 2:110525224-110525246 GGCTTTAAAATAATCTGACAAGG + Intronic
936422442 2:112379778-112379800 GGCTTTAAAATAATCTGACAAGG + Intronic
936474019 2:112824097-112824119 GGCTTAGCACAAATGTGGCATGG - Intergenic
945143624 2:206714022-206714044 TGATTCAAACATATGTGGCAAGG + Intronic
945366677 2:208963360-208963382 AGCTTCAAACTAATATGGCAGGG + Intergenic
945473349 2:210252888-210252910 GACTTCAGACAAATGTGGTAGGG - Intergenic
946209236 2:218134083-218134105 TGGTTTGAACAATTGTGGCATGG - Intronic
946785208 2:223236305-223236327 TGCTGTGAAGAAATGTGGCAGGG - Intergenic
946919127 2:224559784-224559806 TCCTTGAAACAAATTTGGCAAGG + Intronic
947881289 2:233515959-233515981 GACTTTCAACAAAGGTGCCAAGG - Intronic
949042647 2:241856531-241856553 GACTTTAAAAATATGTGTCATGG + Intronic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1169842158 20:9951451-9951473 TGATTTAGACAAATGTAGCATGG - Intergenic
1173646851 20:44638707-44638729 GGCATTAAGCAAATGTCACATGG + Intronic
1176895924 21:14378391-14378413 GGTTTTAAACAAAAATGGAATGG - Exonic
1178982906 21:37280179-37280201 GACTTTCAACAAAGGTGCCAAGG + Intergenic
1181097973 22:20519151-20519173 GTCTTTAAATAAATGTCTCAGGG - Intronic
1182127913 22:27829568-27829590 GGCTTTAAACAGTTGTGACAAGG + Intergenic
949337771 3:2994831-2994853 GGCTTTATACAGATTTGACAGGG + Intronic
949353491 3:3151620-3151642 TACTATAAATAAATGTGGCATGG - Intronic
949870735 3:8585828-8585850 GATTTTCAACAAATGTGCCAAGG - Intergenic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
953206529 3:40834877-40834899 GACTTTAAACCAATGAGGAAAGG + Intergenic
953608236 3:44425857-44425879 GCCTTTCACAAAATGTGGCAAGG - Intergenic
953686584 3:45082874-45082896 GGCTTTAAAGAAAAGAGCCAGGG + Exonic
955590751 3:60532663-60532685 GGCTTTAAACAGTGTTGGCAAGG + Intronic
955956333 3:64293620-64293642 GGCTTTCCACAGATGTGGAACGG - Intronic
956299056 3:67749605-67749627 GACTTTAAACACATTTAGCATGG - Intergenic
956917388 3:73886691-73886713 GGCTTGAAACAGATATGGCCTGG + Intergenic
959386592 3:105716180-105716202 GGTTATAAACAAATGTCACATGG - Intronic
960083979 3:113571108-113571130 GGATTTAAATAAATGTTTCATGG - Intronic
961069299 3:123906726-123906748 GGCTTCTAAGAAATGTGTCATGG - Intronic
963310435 3:143704695-143704717 GGATTAAAAAAAATGTGGCTTGG + Intronic
964219429 3:154326822-154326844 GGCCTTAATCACATGTGCCAAGG - Intergenic
965250019 3:166331048-166331070 GGCTTTAAGCAATTTTGGAAAGG + Intergenic
966122212 3:176535389-176535411 GGATTTAAATAAATGTGGAGAGG + Intergenic
968665502 4:1819676-1819698 CGCTTTAAACAAATGGGGTTTGG - Intronic
969156301 4:5213380-5213402 GGCTTTGAACAAGTGGGGCATGG - Intronic
969307263 4:6332940-6332962 GACTTGAAAGAAATGTGGGATGG - Intronic
969915255 4:10484551-10484573 AGCTTTAAAAAAAAATGGCAGGG + Intergenic
973629737 4:52809152-52809174 GCCTTTCAACAAATGTGGTTTGG + Intergenic
978697374 4:111598092-111598114 GGCATAAAAGAACTGTGGCAAGG - Intergenic
980813256 4:137911156-137911178 GGCTTGAATCAAGTGAGGCATGG + Intergenic
981767700 4:148270529-148270551 GGTTTGAAATAAATATGGCATGG - Intronic
981864110 4:149393938-149393960 ACCTCTAAACAAATGTTGCATGG + Intergenic
982910178 4:161131354-161131376 GGATTGTAGCAAATGTGGCATGG - Intergenic
984315976 4:178132252-178132274 GGCTTTGAAAAAATGTTTCATGG + Intergenic
984405516 4:179324712-179324734 GGCTTAAAAAAAAGGTGGAAGGG - Intergenic
985210864 4:187592911-187592933 GGCTTTTAATAAATGTGCTATGG + Intergenic
986763375 5:10900184-10900206 TGCTATAAACAAGTATGGCAGGG + Intergenic
992259685 5:74957257-74957279 GGCTCCAAACAAAGGTGACAAGG + Intergenic
993248613 5:85485369-85485391 GGGTTTAAACTAGTGTGGAATGG + Intergenic
993516358 5:88840578-88840600 GGCTAGAAACAAATCTGGCAAGG - Intronic
995906948 5:117136036-117136058 TGCTTAAAACAATTGTGGGAAGG + Intergenic
998625529 5:143841620-143841642 GTCATTACACAAATGTGGTAAGG + Intergenic
998916676 5:147020265-147020287 GGCTTTAAATAAATGGTACAAGG - Intronic
999373553 5:151070863-151070885 GGGTTTGGACAAATGTGGAATGG - Intronic
1001129490 5:169052148-169052170 GTCTTTAACCAAATGTGGGATGG - Intronic
1001580278 5:172793550-172793572 GGCTTCAAAGAAATGTGACCTGG + Intergenic
1003055483 6:2814768-2814790 GATTTTTAACAAATGTGCCAAGG - Intergenic
1003421492 6:5962089-5962111 AGCTTTCAACAGATGTGACAAGG - Intergenic
1004050689 6:12075739-12075761 AGCTTTAAAGCAATGTGGGAGGG - Intronic
1004338431 6:14785178-14785200 TGCTTTAAACAAATGGGGGAAGG + Intergenic
1007808298 6:44467566-44467588 GGCTTTTAAAAAATGTTACATGG + Intergenic
1009802411 6:68555897-68555919 CGCTTTATACAAATGCTGCAAGG + Intergenic
1010224667 6:73477953-73477975 AGTTTTAAAAAAATGTGGCGTGG + Intronic
1012799741 6:103809912-103809934 GCCTTAAAATAAATGTGGTAGGG - Intergenic
1013949288 6:115760072-115760094 GGATATAAATAAATGTGGCCTGG - Intergenic
1016512089 6:144854830-144854852 GGCTGTTGACCAATGTGGCATGG + Intergenic
1016882912 6:148928676-148928698 AATTTTGAACAAATGTGGCATGG - Intronic
1017102442 6:150860543-150860565 GGCTTTACACAAATTTGCAAAGG - Intergenic
1017925041 6:158903561-158903583 GGTTTTAACCAAATTTGTCATGG - Intronic
1018365152 6:163112469-163112491 GGCTTGCAACAAATGAGGGAGGG - Intronic
1018550205 6:164988709-164988731 GGCTTTAAAAAAATTGGGCTGGG + Intergenic
1020349515 7:7202457-7202479 GGTTTTTAACAAATGTTGCTGGG - Intronic
1020827212 7:13044207-13044229 GGCTTTAAACATACGTGCCATGG + Intergenic
1021640814 7:22734633-22734655 ATCTTTAAACAAACGAGGCAAGG - Intergenic
1021671079 7:23035707-23035729 TGGTTTAAGAAAATGTGGCACGG + Intergenic
1021850804 7:24806622-24806644 TGCTTTAAACAATTGTATCACGG - Intronic
1022200420 7:28111258-28111280 GCCTATAACCAGATGTGGCAAGG - Intronic
1024144189 7:46494970-46494992 GACTTTCAACAAAGGTGACAAGG + Intergenic
1024782743 7:52870715-52870737 GGATTAAAAAAAATGTGGTATGG + Intergenic
1024817687 7:53290424-53290446 GGCTCTATACAAATGTGGACTGG + Intergenic
1032536772 7:132671121-132671143 GGCTTCAAACTAGTGTGGGAGGG + Intronic
1036497377 8:9281563-9281585 CGCTTTAAAGAAATATGGCTTGG + Intergenic
1037678932 8:21076935-21076957 CACTTTAAACAAAGGTGGCAAGG + Intergenic
1037918361 8:22786614-22786636 GGCTTTAAAAAAAAGTTGCTAGG + Intronic
1038272137 8:26083708-26083730 GGCTTTACCGAAAAGTGGCAGGG + Intergenic
1038542327 8:28400394-28400416 GGGTTTAAACAAAGTTGGTAGGG + Intronic
1038650121 8:29394862-29394884 GGCTGCAAACAACTGTGGAATGG - Intergenic
1039011142 8:33094366-33094388 GACATTTAATAAATGTGGCAAGG + Intergenic
1039894115 8:41704309-41704331 GGCTTTACCCTGATGTGGCATGG + Intronic
1040799963 8:51329473-51329495 GGCTTTAAACAAAATTTACAAGG + Intronic
1043158740 8:76819093-76819115 TGCTTTAAACTAGTGTGGGAAGG + Intronic
1044213226 8:89575344-89575366 GCCTTTCAACAAATGTTGCTAGG - Intergenic
1044382883 8:91554830-91554852 GAGATTAAACAAATGTGGCAAGG + Intergenic
1045341291 8:101256963-101256985 GGCTTTAAACATATGACGCCCGG - Intergenic
1047968397 8:130064293-130064315 GGTTTTAAATAGATGTGGAAGGG + Intronic
1048048207 8:130792932-130792954 GCCTTTAAACCAGCGTGGCAGGG - Intronic
1048920714 8:139227421-139227443 GGCTTTATACAACAGTGGCAGGG + Intergenic
1049955502 9:689231-689253 GGCTTAAAACTAGTGTCGCATGG - Intronic
1051148198 9:14052391-14052413 GGTTTTAAAAAGATGTGGAAGGG + Intergenic
1054811132 9:69434729-69434751 TGCTTTAAAAAAATGTAGCATGG - Intronic
1057984318 9:99695402-99695424 GATTTTAAACAAAGGTGCCAAGG + Intergenic
1060029942 9:120205611-120205633 GGATTCAAACTAATATGGCAGGG + Intergenic
1060433453 9:123570864-123570886 GCCTTTAAAGAAATATGGCGTGG + Intronic
1061000106 9:127898059-127898081 GGATTCAAGCAGATGTGGCAAGG + Intronic
1186735613 X:12460524-12460546 GATTTTAAACAAAGGTGTCATGG - Intronic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188155750 X:26740256-26740278 GGCCTTACACAAATGTTGCAGGG - Intergenic
1188464653 X:30466175-30466197 GGGTTCAAAAAAATGTGGAAAGG - Intergenic
1188640546 X:32496958-32496980 GTCTGTATACAAATGTGGCATGG - Intronic
1190467026 X:50735238-50735260 TCTTTTAAACAAATGTTGCAGGG + Intronic
1191951953 X:66602373-66602395 GATTTTAAAGGAATGTGGCACGG - Intronic
1193878044 X:86886323-86886345 GGGTTTAAACAAATGTATAAGGG - Intergenic
1194239297 X:91423895-91423917 GGCTTTAATCAAATGGAGCCTGG + Intergenic
1194607673 X:96001663-96001685 GGAATTAAACAAATTTAGCATGG + Intergenic
1196064117 X:111443885-111443907 GCCTTTAAATATATGTGGTATGG - Intergenic
1197520104 X:127486634-127486656 GGCTTCTAACAAATGGGGCGCGG + Intergenic
1197983095 X:132238913-132238935 GGTTTTAAACCAATGTGCTATGG - Intergenic
1201260561 Y:12154892-12154914 GACTCTAAAAAAATGTGGCCAGG - Intergenic
1201474115 Y:14362458-14362480 TGCTTGAAACATCTGTGGCAGGG - Intergenic
1202170407 Y:22037539-22037561 GCCTTTAAACAAATGGTGCCAGG + Intergenic
1202220957 Y:22548834-22548856 GCCTTTAAACAAATGGTGCCAGG - Intergenic
1202322155 Y:23646829-23646851 GCCTTTAAACAAATGGTGCCAGG + Intergenic
1202548613 Y:26023227-26023249 GCCTTTAAACAAATGGTGCCAGG - Intergenic