ID: 1139209208

View in Genome Browser
Species Human (GRCh38)
Location 16:65059741-65059763
Sequence AAACACGCCTTGTCCAATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139209203_1139209208 28 Left 1139209203 16:65059690-65059712 CCGGGCACTTGACAACTGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG 0: 1
1: 0
2: 0
3: 1
4: 51
1139209206_1139209208 7 Left 1139209206 16:65059711-65059733 CCAGGGACAATAGAATTCTTGTG 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG 0: 1
1: 0
2: 0
3: 1
4: 51
1139209202_1139209208 29 Left 1139209202 16:65059689-65059711 CCCGGGCACTTGACAACTGAAGC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG 0: 1
1: 0
2: 0
3: 1
4: 51
1139209201_1139209208 30 Left 1139209201 16:65059688-65059710 CCCCGGGCACTTGACAACTGAAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139209208 Original CRISPR AAACACGCCTTGTCCAATGC CGG Intronic
900089428 1:913396-913418 AAACACGCCATGCCCATTGGAGG + Intergenic
906912841 1:49973794-49973816 AAAAAATCCTTGTCCTATGCAGG - Intronic
909410611 1:75346108-75346130 AATCATGCCATGTCCAATGTGGG - Intronic
914948644 1:152089921-152089943 AAACACTCCTTGTCAAAGGATGG + Intergenic
916233858 1:162566087-162566109 AAACTCACGTTGTCCAAAGCTGG + Exonic
920682834 1:208085607-208085629 TAAGAAGCCTTGTGCAATGCCGG + Intronic
1064179425 10:13101181-13101203 AAACTTGCCTTGTCCACTCCAGG - Intronic
1067184678 10:44016428-44016450 AAACTGGCCCTTTCCAATGCAGG - Intergenic
1072612581 10:97028469-97028491 AAACACCCTTTATCCTATGCTGG + Intronic
1075779402 10:125007117-125007139 AAACCTGCCTTGTCCATTTCAGG + Intronic
1084389996 11:68869125-68869147 AAACAGGCCTGGATCAATGCTGG - Intergenic
1084480369 11:69416298-69416320 AACCAGGCCTTGTCAACTGCAGG - Intergenic
1097514647 12:60589684-60589706 AAACAAGACTTGTCCTCTGCAGG + Intergenic
1102320406 12:111928658-111928680 AAACACCCATTTTCCCATGCAGG + Intergenic
1102987031 12:117286505-117286527 AGCCAGGCCTTGTCCAAAGCGGG + Intronic
1117987102 14:61397314-61397336 AAACTCCACTTGTCCAAAGCTGG - Intronic
1118287844 14:64492822-64492844 CTCCACGCCTTGTACAATGCAGG - Intronic
1120739846 14:88096043-88096065 AAACAGGCCTGGTGCAATCCTGG - Intergenic
1130932458 15:88439343-88439365 AAACAAACCTTGTCCCATGGTGG + Intergenic
1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG + Intronic
1139323443 16:66133829-66133851 AAACACGTCTTTCCCAATCCAGG + Intergenic
1139491025 16:67286111-67286133 AATCACCCCTTGTTCAAAGCAGG + Intronic
1143622192 17:8087071-8087093 CTACACGCCTTGTCCAGAGCTGG - Intronic
1148777924 17:50105935-50105957 AAGCACGCCTTGTGCCATGGTGG - Exonic
1150261437 17:63795240-63795262 AAGCATGCCTTGTCTAATGTAGG - Intronic
1151195226 17:72426397-72426419 GAAAATGCCATGTCCAATGCTGG + Intergenic
1155957053 18:31963005-31963027 AAAGACGGCTTCTCCAATGAGGG - Intergenic
1161661163 19:5547152-5547174 AAACCCGCGTTGTCCAACGTGGG + Intergenic
941203906 2:162547830-162547852 AAACACGCCTTTTCCTGTGTTGG - Intronic
942154977 2:173119187-173119209 AAACACACCTTCTCCAATAAGGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175428589 20:58887831-58887853 AAAGAGGCCTTGTACAATGGGGG + Intronic
1181340942 22:22179377-22179399 AAAGATGCCTTGGCCAGTGCAGG + Intergenic
954392315 3:50274178-50274200 AAACAAGCCTTGTCTTATGATGG - Intronic
969973582 4:11073820-11073842 AAACATGCCTTGTTCAGTGCTGG - Intergenic
970118134 4:12722290-12722312 AAAGTCACCTTGTCAAATGCTGG + Intergenic
981741546 4:148007378-148007400 AAACACTCCCTGTACCATGCTGG - Intronic
987283134 5:16430383-16430405 AAACATACCTTCTCTAATGCGGG + Intergenic
988706631 5:33732626-33732648 AAAAATACTTTGTCCAATGCTGG + Intronic
995156416 5:108918781-108918803 AAACACACCCAGTCCAAGGCGGG - Intronic
1004315507 6:14583786-14583808 GACCACCCCTTGTCCAATGTGGG + Intergenic
1006750920 6:36376353-36376375 CAGCACGCCTAGTCCAGTGCTGG - Intronic
1012228857 6:96737070-96737092 AAAGATGCCTTCACCAATGCAGG + Intergenic
1014518572 6:122409423-122409445 AAACCCCCCTTCTCCAATTCAGG - Intronic
1019958795 7:4439272-4439294 AAAAGTGTCTTGTCCAATGCAGG - Intergenic
1024351837 7:48374363-48374385 AAATACCCCTTGTCCAAAGGCGG - Exonic
1024981772 7:55163113-55163135 AAACACTCCTTGTTCGCTGCTGG + Intronic
1026601124 7:71777997-71778019 AAAGACTCATTGTCCAATGTGGG - Intergenic
1033156251 7:138959457-138959479 AAAGACCCTTTGTCCTATGCAGG - Intronic
1039714634 8:40094077-40094099 CACCACGCCTGGCCCAATGCAGG + Intergenic
1041483769 8:58351537-58351559 AAACACTTCTTTTCTAATGCTGG - Intergenic
1049417315 8:142501023-142501045 AAACACTTGTTGTCGAATGCTGG + Intronic
1057517043 9:95730495-95730517 TAACTGGCCTTATCCAATGCAGG - Intergenic