ID: 1139212361

View in Genome Browser
Species Human (GRCh38)
Location 16:65092106-65092128
Sequence TGCCATAGTCATAGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139212355_1139212361 10 Left 1139212355 16:65092073-65092095 CCTGTCATAGATGTTGTGCCTCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 161
1139212354_1139212361 27 Left 1139212354 16:65092056-65092078 CCACAATGTGAGATTGTCCTGTC 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 161
1139212356_1139212361 -8 Left 1139212356 16:65092091-65092113 CCTCTTCCCATAGAATGCCATAG 0: 1
1: 0
2: 0
3: 5
4: 159
Right 1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139212361 Original CRISPR TGCCATAGTCATAGATGGCA GGG Intronic
900426641 1:2583373-2583395 TGTCTTAGTCATAGATGGGGTGG - Intergenic
902563330 1:17292723-17292745 CGCCATATTCATAGATTGAAAGG + Intergenic
905305674 1:37016142-37016164 TTCCAGAGTCACAGATGGGATGG - Intronic
906732633 1:48096409-48096431 CCCCACAGTCATGGATGGCAGGG - Intergenic
907116522 1:51973403-51973425 TGGTATAGCCATAGATGACATGG - Intronic
908441824 1:64162898-64162920 TTCCAGAGTCATACCTGGCAGGG - Intronic
908831187 1:68180126-68180148 GGCCACAGTGATAGCTGGCATGG - Intronic
908967163 1:69779574-69779596 TGCCATTGTCTTAGAAGGAAGGG - Intronic
910333224 1:86099726-86099748 TGCCATCATCACAAATGGCATGG + Intronic
912656302 1:111489001-111489023 TGCCATGGTCATGGATGAAAAGG - Exonic
912663271 1:111554385-111554407 TTCCAAAGTCAAAGGTGGCATGG + Intronic
918256033 1:182748270-182748292 TGCCATAGGCAGAGATGGTTAGG - Intergenic
918432828 1:184480022-184480044 TTACAAAGTCCTAGATGGCAAGG - Intronic
920153226 1:203926419-203926441 TGGCATAAACCTAGATGGCATGG + Intergenic
922109115 1:222540208-222540230 TCCCATAGGCATAGATGGCGGGG + Exonic
1066285942 10:33966188-33966210 GGCCATAGTCACTGATGGCAGGG + Intergenic
1069277995 10:66616955-66616977 TTCTATATTCATAGAGGGCAGGG - Intronic
1071587820 10:86842348-86842370 TTCCATACTCACAGAAGGCAAGG + Intronic
1072091889 10:92136984-92137006 AACCATAGGCATAGATGCCATGG - Intronic
1074981139 10:118620805-118620827 AGCCATGGTGAAAGATGGCAGGG - Intergenic
1075076726 10:119356963-119356985 TGGCATTGTCAAAGAAGGCAGGG + Intronic
1075410615 10:122225367-122225389 TGCATTAGTCATAGATGCCGGGG + Intronic
1076694435 10:132240333-132240355 TGTCACAGTCACACATGGCAGGG + Intronic
1078234752 11:9473942-9473964 TGCAAAACTCATAGATGGCCAGG + Exonic
1078485639 11:11720877-11720899 TGACATAGTCACAGATTCCAGGG + Intergenic
1078699397 11:13667222-13667244 AGCCATAGTCATAAATAGCCAGG - Intergenic
1079268139 11:18955980-18956002 TGCAATTGTCAAGGATGGCAGGG + Intergenic
1079733707 11:23968770-23968792 TAACATAGTCACAGATTGCAGGG - Intergenic
1080789237 11:35506570-35506592 TGCCATATTCTTGGGTGGCAGGG + Intronic
1081580615 11:44349050-44349072 TGTCATCCTCAAAGATGGCAGGG - Intergenic
1083371004 11:62180952-62180974 TTCCATATTCATGGATGGAAAGG - Intergenic
1083514606 11:63245014-63245036 TTCCCTAGCAATAGATGGCATGG + Intronic
1083759764 11:64809482-64809504 TGCCAAAGTCACACACGGCATGG - Intronic
1084769704 11:71334642-71334664 TCCCACAGACACAGATGGCAGGG - Intergenic
1084889807 11:72231081-72231103 TCCCAAAGACATAGATGTCATGG - Exonic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1089928585 11:122285361-122285383 AGCCATGGTTATAAATGGCAAGG - Intergenic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1093545922 12:20347819-20347841 TTCCATGCTCATAGATTGCAAGG + Intergenic
1100039814 12:90301975-90301997 TGACATATGCAAAGATGGCATGG - Intergenic
1101721038 12:107350975-107350997 TGCCATAGTGCTGGATGGGAAGG + Intronic
1104035556 12:125094872-125094894 TGCCATTTTCAGAGATGTCAGGG + Intronic
1104124676 12:125835002-125835024 TTACACAGACATAGATGGCATGG + Intergenic
1109234000 13:59793165-59793187 TGCCATTGTGATAGATTGAAAGG - Intronic
1111918717 13:94388525-94388547 TGCCATTTTGATACATGGCAAGG + Intronic
1112190211 13:97169721-97169743 TGGCACAGTCATAAATGGAAGGG - Intergenic
1113059260 13:106303604-106303626 TGCTATATGCATAGATTGCATGG - Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117907080 14:60601399-60601421 TGCCATAGTGATAGAGTCCAAGG + Intergenic
1119680542 14:76589331-76589353 TAACATAGTCATAGATTCCAGGG + Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1123150844 14:106180358-106180380 TGCCATAGTGGAAGATGGCATGG - Intergenic
1123399261 15:19968217-19968239 TGCCATAGTGGAAGACGGCATGG - Intergenic
1125927393 15:43573904-43573926 TGACACAGTCATAGATGTCAGGG + Exonic
1125940536 15:43673469-43673491 TGACACAGTCATAGATGTCAGGG + Intergenic
1129043429 15:72710722-72710744 TGCCATAGGTATAAATGCCATGG - Intronic
1131438736 15:92442766-92442788 AGCCACAGTCAAAGATAGCAAGG + Intronic
1132142113 15:99404894-99404916 TGCACTTGTCATAGATTGCATGG - Intergenic
1138162656 16:54770027-54770049 TACCATATTCATGGATGGAATGG + Intergenic
1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG + Intronic
1140284975 16:73594331-73594353 TGCCATATTTATAAATGGGAAGG + Intergenic
1140715997 16:77726179-77726201 GGCCAAAGTCACAGCTGGCAAGG - Intronic
1148883591 17:50753946-50753968 GGCCTTAGTCATAGATGTCCTGG - Exonic
1150110651 17:62496519-62496541 TCCCATAGTCAAGTATGGCAAGG + Intronic
1153460725 18:5329814-5329836 TGCCAGACTCTTAGATGGGAAGG + Intergenic
1155493016 18:26418247-26418269 TGAAATATTCAGAGATGGCAAGG - Intergenic
1156039329 18:32802636-32802658 TGCCATAATCATTGATACCATGG - Intergenic
1156438420 18:37158513-37158535 GGCCATAGTCACAGAGGGGATGG + Intronic
1156615755 18:38782792-38782814 TGACATAGTCATAGGTTGAAGGG - Intergenic
1158367337 18:56752434-56752456 TGCCATAAAGAGAGATGGCAAGG - Intronic
1159555737 18:69942785-69942807 TGCCCTAGTCAGAGAAGGCCAGG + Intronic
1159901271 18:74048948-74048970 TACCATTTTCATAGATGGAAAGG - Intergenic
1161899779 19:7109831-7109853 TGCCATGGTCATATAAGGTAAGG + Intergenic
1162061356 19:8097370-8097392 TGCCATTGGCACAGATGGCGGGG + Exonic
926401647 2:12503189-12503211 TGCCATAGAAATAGATAACATGG + Intergenic
928838689 2:35579219-35579241 TGCCAGTATCATAGATGGAAAGG + Intergenic
929074436 2:38067023-38067045 TGCCACACTCACAGATGACAGGG - Exonic
931478522 2:62615964-62615986 TGCCATGATTATAAATGGCAGGG - Intergenic
932888135 2:75565608-75565630 TGCCATAGTGGAAGAAGGCAAGG - Intronic
934720660 2:96573583-96573605 TGCCAAAGCCAAACATGGCAGGG + Intergenic
938633302 2:133193231-133193253 TGCCAGAGTTATAAAGGGCATGG + Intronic
941311713 2:163940879-163940901 TGCCATCATGATAGTTGGCATGG + Intergenic
943043641 2:182832405-182832427 TGCTATATTCTCAGATGGCAAGG - Intergenic
1176023924 20:62976226-62976248 AGCCATAAAAATAGATGGCAAGG - Intergenic
1177211793 21:18080953-18080975 TCCCATGCTCATAGATTGCAAGG - Intronic
1177747493 21:25236751-25236773 TGCCATATTCTTGGTTGGCAGGG - Intergenic
1177937517 21:27367803-27367825 AACCATAGGCATAGATGCCACGG + Intergenic
1179013910 21:37578108-37578130 TGCAATAGTTATATGTGGCAGGG - Intergenic
1184021603 22:41825300-41825322 AGCCAGAGTCACAGATGACAAGG - Intronic
949589665 3:5480994-5481016 TGCCCTAGCTATAGATGCCAAGG - Intergenic
951082558 3:18469030-18469052 TGACATTGTTATAGATGACACGG + Intergenic
952126739 3:30309611-30309633 AGCCCTAGTGATGGATGGCAAGG - Intergenic
952397387 3:32932900-32932922 TGCCATGTTCATGGATGGGAAGG - Intergenic
953505540 3:43482577-43482599 TCCAATAGTCAAAGATGGCCAGG + Intronic
958794577 3:98693229-98693251 TGCCATAGTCAGGAATGACATGG - Intergenic
960637392 3:119796784-119796806 TGCCATAGACAGATCTGGCAGGG - Intronic
962729097 3:138263240-138263262 TGCTATAGTGAAAGATGGCAAGG + Intronic
963982460 3:151554844-151554866 TGCCATTTTCATAGCTTGCAAGG + Intergenic
964099373 3:152970104-152970126 AGGCATTGTCCTAGATGGCAGGG - Intergenic
964621559 3:158724315-158724337 TAACATAGTCACAGATGCCAGGG - Intronic
964710010 3:159661829-159661851 TGCCAAAGTCCTGGAGGGCAAGG - Intronic
965056960 3:163731955-163731977 TGCCATAGAAATAAATGACACGG + Intergenic
965512786 3:169587354-169587376 TGCCATTGGCACATATGGCATGG + Intronic
967105501 3:186252005-186252027 TCCCATAGTCACAGATGCCCTGG - Intronic
967228203 3:187313057-187313079 TGCGAGAGACAGAGATGGCATGG - Intergenic
968376738 4:50180-50202 TGCCTCAGTGGTAGATGGCAGGG + Intergenic
971083021 4:23237268-23237290 TGCATTAATCATAGATGTCAGGG + Intergenic
976447358 4:85146537-85146559 TGCCATAGTGATATATGTAAAGG + Intergenic
979394423 4:120169060-120169082 TGCCAGAGTCTTCCATGGCATGG + Intergenic
979977895 4:127219376-127219398 TGGCATGGTCATAGATTGAAAGG - Intergenic
980177616 4:129365909-129365931 TGTCTTTGTCAGAGATGGCAGGG + Intergenic
981126868 4:141117173-141117195 TACCATATCCATAGGTGGCAAGG + Intronic
981731056 4:147899011-147899033 TGTCCTACTCAGAGATGGCATGG - Intronic
987833958 5:23136799-23136821 TGGCATATTCATAGATGACAAGG - Intergenic
991176925 5:63699317-63699339 AGACACAGTAATAGATGGCATGG - Intergenic
991642767 5:68771102-68771124 TCCCAAAGTCACAGATTGCAAGG - Intergenic
992214736 5:74514934-74514956 TGCCTTAGTCACAGAAAGCAGGG + Intergenic
993087778 5:83384787-83384809 TTCCATGTTCATAGATGGGAAGG + Intergenic
993377046 5:87160876-87160898 AGCCCTAGTAGTAGATGGCAGGG - Intergenic
995540488 5:113181491-113181513 TTCTACAGTTATAGATGGCAAGG - Intronic
996838397 5:127819596-127819618 TGCCACAGTGAAAGATAGCATGG + Intergenic
1000172727 5:158719068-158719090 TGACAAAGTCATATTTGGCATGG + Intronic
1000232505 5:159329235-159329257 AGATATAGTCACAGATGGCATGG + Intronic
1004668543 6:17772826-17772848 TCCCTTAGTCATATATAGCAGGG - Intronic
1006911633 6:37566968-37566990 TGCCAGAGTAATAGATGGGTAGG - Intergenic
1011230491 6:85155774-85155796 TGCCAAAGTCATAGAAGGGCTGG + Intergenic
1011828944 6:91346726-91346748 TGCCTGTCTCATAGATGGCACGG + Intergenic
1013797778 6:113905789-113905811 TGCCATAGCCCTTGATGGGAAGG - Intergenic
1014632868 6:123808705-123808727 TGCCAGAGTCATCTCTGGCATGG + Intronic
1015367393 6:132411727-132411749 TGACATAGACATTGATGACAGGG + Intergenic
1015691819 6:135932945-135932967 TCTATTAGTCATAGATGGCATGG + Intronic
1016607335 6:145945554-145945576 TGACATACTTATAGATGGAAAGG + Exonic
1017574476 6:155786849-155786871 TGCTGTAGTTATAGATGCCATGG - Intergenic
1020866078 7:13564496-13564518 TCACCTAGTCATTGATGGCATGG + Intergenic
1022340278 7:29461096-29461118 GGCCAAAGTAATAAATGGCAGGG + Intronic
1026951984 7:74353818-74353840 TGGCACAGGCAGAGATGGCAGGG - Intronic
1029234008 7:99097541-99097563 TTCCATAGTGAAAGATGGAAGGG - Intronic
1037085909 8:14850300-14850322 TGGCATAGTCATGGTTGTCAAGG + Intronic
1041674146 8:60521156-60521178 TGCCTTTGTCTTAGATGCCAGGG + Intronic
1051937381 9:22459499-22459521 TGCCACAGTCAAGGATGGAAGGG - Intergenic
1052119084 9:24686733-24686755 TGCCATACCTATAGATGGCGAGG + Intergenic
1055193521 9:73557747-73557769 TGGCACAGTCATAGTAGGCAGGG - Intergenic
1056114773 9:83431231-83431253 TGTCATATTCATTTATGGCAGGG - Intronic
1057134054 9:92674217-92674239 TGCCATGGTCATGGAAGACAAGG + Intergenic
1059626636 9:116073982-116074004 TGCCAGAGTCAGACATGCCAGGG - Intergenic
1060980891 9:127791185-127791207 TCCCAAAGTCATTGGTGGCAGGG + Intergenic
1062205716 9:135335794-135335816 TGCCTTGGTCATAGAGGGCCGGG - Intergenic
1203758809 EBV:850-872 AGCTATAATCAGAGATGGCATGG - Intergenic
1203572492 Un_KI270744v1:144066-144088 TGCCTCAGTGGTAGATGGCAGGG - Intergenic
1186227837 X:7420462-7420484 TGCCATAGTAATAGTTGCCTGGG + Intergenic
1186754951 X:12660904-12660926 TGCCATAGTGAAAGCTGGCCAGG + Intronic
1188404227 X:29786890-29786912 TGCCATTTACAAAGATGGCAAGG + Intronic
1188717726 X:33480970-33480992 TTCCATACTCATAGGTGGGAGGG + Intergenic
1190132633 X:47764288-47764310 TTCCTTATTCACAGATGGCATGG - Intergenic
1192600638 X:72460070-72460092 TGACATAGTCATAAATGTCTGGG + Intronic
1193864703 X:86717128-86717150 TGTCATATGCATAGATTGCATGG + Intronic
1194110898 X:89833458-89833480 TGACATAGTTATAAATGGGATGG - Intergenic
1194161544 X:90458656-90458678 TGCCATACTCACTGATTGCAAGG - Intergenic
1194294779 X:92114308-92114330 AACCATAGGCATAGATGTCACGG + Intronic
1194920346 X:99758060-99758082 TGCCATAGCCCTTGGTGGCAAGG - Intergenic
1196151342 X:112378127-112378149 TGCGATAGTGATGGATGACATGG - Intergenic
1196750813 X:119115873-119115895 TGCTATAGTCACAGGGGGCATGG - Intronic
1200463556 Y:3488204-3488226 TGACATAGTTATAAATGGGATGG - Intergenic
1200507831 Y:4036389-4036411 TGCCATACTCACTGATTGCAAGG - Intergenic
1200612276 Y:5338811-5338833 AACCATAGGCATAGATGTCACGG + Intronic
1200914518 Y:8559763-8559785 TGCCATCCCCACAGATGGCATGG + Intergenic
1201596471 Y:15675604-15675626 TTCCATACTCATGGATGGGAAGG + Intergenic
1201765374 Y:17569566-17569588 CGCCAGAGTCCCAGATGGCAGGG + Intergenic
1201836178 Y:18336423-18336445 CGCCAGAGTCCCAGATGGCAGGG - Intergenic