ID: 1139215323

View in Genome Browser
Species Human (GRCh38)
Location 16:65121385-65121407
Sequence GCTTTCGGCAGGGATCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139215306_1139215323 24 Left 1139215306 16:65121338-65121360 CCCGGGCTTACCCGGCAGTCTCG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG 0: 1
1: 0
2: 1
3: 2
4: 82
1139215311_1139215323 13 Left 1139215311 16:65121349-65121371 CCGGCAGTCTCGACTGCAGGGAC 0: 1
1: 0
2: 1
3: 15
4: 133
Right 1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG 0: 1
1: 0
2: 1
3: 2
4: 82
1139215310_1139215323 14 Left 1139215310 16:65121348-65121370 CCCGGCAGTCTCGACTGCAGGGA 0: 1
1: 0
2: 1
3: 15
4: 334
Right 1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG 0: 1
1: 0
2: 1
3: 2
4: 82
1139215307_1139215323 23 Left 1139215307 16:65121339-65121361 CCGGGCTTACCCGGCAGTCTCGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139215323 Original CRISPR GCTTTCGGCAGGGATCCGGG AGG Intronic
900543955 1:3218176-3218198 GCTCTCGGCAGGGAGCCGCAGGG + Intronic
902771322 1:18646995-18647017 GCCTTGGGCGGGGATCCCGGAGG + Intronic
902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG + Intergenic
903334951 1:22618578-22618600 GCCTTGGGCAGGGGGCCGGGTGG + Intergenic
903539142 1:24086995-24087017 GGTCTCGGTAGGAATCCGGGTGG - Intronic
904267477 1:29326010-29326032 GCTTTTGGCAGGGATGAGTGAGG + Intronic
905684306 1:39897863-39897885 GCTTCATGCAGGGATCCAGGGGG + Exonic
916084545 1:161259005-161259027 GCTGTCGGCAGGGCTGCGGCGGG + Intronic
1062828097 10:587029-587051 GCTGTCAGCAGGGACCCAGGTGG - Intronic
1062828111 10:587089-587111 GCTATCAGCAGGGATCCGGGTGG - Intronic
1062828127 10:587149-587171 ACTGTCAGCAGGGACCCGGGTGG - Intronic
1062843926 10:690128-690150 GATTTTCGCAGGGAGCCGGGTGG - Intergenic
1066243227 10:33557919-33557941 GCTTTCCGGAGGGATGCTGGAGG - Intergenic
1076521873 10:131086378-131086400 GCTTTGGGCAGGGCTCAGTGTGG + Intergenic
1077198825 11:1295337-1295359 GCTGCCGGCGGGGGTCCGGGAGG + Intronic
1078090736 11:8263082-8263104 GCTCGCGGCCGGGACCCGGGGGG + Intronic
1084302069 11:68258498-68258520 GCTTTCGGCAGGGACGGGTGTGG + Intergenic
1097248806 12:57621175-57621197 GCTTTCGGCTTGGGTTCGGGAGG + Intronic
1097288451 12:57895170-57895192 GCATGCGGCAGGGTTCAGGGAGG + Intergenic
1105496718 13:20936802-20936824 GCTTTTGGGAGGGTTCTGGGAGG + Intergenic
1108777657 13:53785621-53785643 GCTTGAGGCAGGGATCAGGATGG + Intergenic
1113047362 13:106170289-106170311 GCTTTCTGGAGGGAACTGGGAGG - Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1129188903 15:73926538-73926560 GCTCTCCGCAGGGCACCGGGCGG - Exonic
1129334776 15:74845330-74845352 CCTTTCTCCAGGGATCTGGGTGG - Intronic
1132535601 16:477980-478002 GTTTGCGGCAGGGCTCCAGGTGG + Intronic
1132665363 16:1078967-1078989 GCCCTCGGCAGGGGCCCGGGCGG + Exonic
1133671561 16:8026925-8026947 CCTTTTGGCAGGGGTCAGGGTGG - Intergenic
1133781395 16:8941835-8941857 GGGTTCGGCAGGGAACTGGGTGG + Intronic
1135905387 16:26507296-26507318 GCTTTGGGCAGGGATATGGAAGG - Intergenic
1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG + Intronic
1142508444 17:380527-380549 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508470 17:380593-380615 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508495 17:380659-380681 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508556 17:380833-380855 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508574 17:380877-380899 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508600 17:380946-380968 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508695 17:381211-381233 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508729 17:381299-381321 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508768 17:381392-381414 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1147237422 17:39068148-39068170 GCTTTCGGCAGGTTTCCCAGTGG - Intronic
1149993761 17:61396582-61396604 GCTGGCGCCAGGGCTCCGGGAGG + Intergenic
1153805576 18:8706199-8706221 GGTCACGGCAGGGATCCGGGCGG - Intronic
1157260678 18:46173688-46173710 GCTTTCGGAAGGGCTTCAGGAGG + Intronic
1160192243 18:76723805-76723827 GCTCTCCGCAGGCATCAGGGTGG - Intergenic
1161990543 19:7681712-7681734 GCTTTCCGCAGGGGGCCGGCAGG + Intronic
1162127155 19:8505902-8505924 GCTCCCGGCAGGGTTCCGCGCGG + Intergenic
1162332879 19:10041220-10041242 GCTTTGGATAGGGATCCGGCAGG - Intergenic
1162562054 19:11422623-11422645 GCTGGCTGCAGGGAGCCGGGAGG + Exonic
1167793531 19:51694652-51694674 GAGTTGGGCAGTGATCCGGGAGG + Intergenic
925534426 2:4901249-4901271 GGCTCCGGCAGGGCTCCGGGGGG + Intergenic
928305282 2:30164849-30164871 GCATTGGGCTGGGATCCTGGGGG - Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
934862124 2:97773188-97773210 GATTGCGGCAGGGTTCCGGCTGG + Intronic
935578582 2:104736124-104736146 GATGTCTGCAGGGATCCAGGTGG - Intergenic
936542243 2:113361798-113361820 GCCTGGGGCAGGGATCCCGGAGG + Intergenic
937218929 2:120330304-120330326 GCTGTCGGCAGGGGTGTGGGGGG + Intergenic
942965971 2:181892284-181892306 GCTCCCGGCCGGGCTCCGGGGGG + Intronic
1169889113 20:10433879-10433901 GCGGTCGGCACGGATGCGGGCGG - Intronic
1175141378 20:56862707-56862729 GGTTTCTGCTGGGATCCAGGGGG - Intergenic
1175787472 20:61721023-61721045 GCTCAGGGCAGGGAGCCGGGGGG - Intronic
1176377604 21:6094206-6094228 GCTCCCGGCACGGCTCCGGGGGG + Intergenic
1179716313 21:43290541-43290563 GCTTGCTGCTGGGATGCGGGTGG - Intergenic
1179745871 21:43444038-43444060 GCTCCCGGCACGGCTCCGGGGGG - Intergenic
1182761218 22:32723817-32723839 GCCTCCGGCAAGGATCCAGGCGG - Intronic
1183233236 22:36596275-36596297 CCTGACGGCAGGGATTCGGGAGG + Intronic
1183331738 22:37225981-37226003 GCTTTGGGTGGGGATCCTGGAGG + Exonic
1183565938 22:38615505-38615527 GCTTTCCTCAGGGATCCAGAGGG - Intronic
949533742 3:4979746-4979768 GCTTTGGGCAGGCAGGCGGGGGG - Exonic
953161771 3:40427321-40427343 GCTTTCAGCTGGGATCTGGTTGG - Exonic
957639427 3:82832330-82832352 CCTGTCAGCAGGGATCGGGGAGG + Intergenic
968905405 4:3448451-3448473 CCTTCCGGCAGGGCTCTGGGTGG - Intronic
986737989 5:10681896-10681918 GCTTCCTGCAGGGATGCTGGTGG - Intronic
998658381 5:144207175-144207197 GCGGTCGGCAGGGAGCAGGGAGG - Exonic
1002279692 5:178123085-178123107 GCTGAGAGCAGGGATCCGGGAGG - Exonic
1015008261 6:128311006-128311028 TCTTTCTGCTGGGATCCCGGGGG - Intronic
1021433902 7:20592736-20592758 GTTTTCTGCAGGGATGTGGGTGG + Intergenic
1023311864 7:38895741-38895763 GCTTTTGGCAGAGATGGGGGAGG - Intronic
1029608900 7:101616152-101616174 GCTTTGGGCTGGGGTCAGGGTGG - Intronic
1029696149 7:102214656-102214678 GGTGTCGGCATGGCTCCGGGGGG - Intronic
1037928894 8:22865694-22865716 CCTTTCCTCTGGGATCCGGGCGG - Intronic
1049694402 8:143976457-143976479 GCTGACCGCAGGGCTCCGGGCGG - Intronic
1056555398 9:87683761-87683783 TCTTTAGCCAGGGATCGGGGAGG + Intronic
1057217826 9:93239160-93239182 GCTCTTTGCAGGGATCCGGGAGG - Intronic
1061540484 9:131275710-131275732 GCTTTAGGCAGGTATGCAGGTGG - Intronic
1196070863 X:111520173-111520195 TCTTTTGGCAGGGATCAGGAAGG - Intergenic