ID: 1139222480

View in Genome Browser
Species Human (GRCh38)
Location 16:65197953-65197975
Sequence GAAGGGAATTTTCAGTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139222480_1139222489 24 Left 1139222480 16:65197953-65197975 CCCATCTACTGAAAATTCCCTTC No data
Right 1139222489 16:65198000-65198022 CCATGTTAGTTGGTGCTGCTAGG No data
1139222480_1139222482 -10 Left 1139222480 16:65197953-65197975 CCCATCTACTGAAAATTCCCTTC No data
Right 1139222482 16:65197966-65197988 AATTCCCTTCTGTATGTTCCAGG No data
1139222480_1139222486 14 Left 1139222480 16:65197953-65197975 CCCATCTACTGAAAATTCCCTTC No data
Right 1139222486 16:65197990-65198012 AGATTTCAGCCCATGTTAGTTGG No data
1139222480_1139222490 25 Left 1139222480 16:65197953-65197975 CCCATCTACTGAAAATTCCCTTC No data
Right 1139222490 16:65198001-65198023 CATGTTAGTTGGTGCTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139222480 Original CRISPR GAAGGGAATTTTCAGTAGAT GGG (reversed) Intergenic
No off target data available for this crispr