ID: 1139225278

View in Genome Browser
Species Human (GRCh38)
Location 16:65228491-65228513
Sequence TTCCAAGATTTCCCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139225278_1139225282 17 Left 1139225278 16:65228491-65228513 CCAGGTGTAGGGAAATCTTGGAA No data
Right 1139225282 16:65228531-65228553 GAACATGAACACAGAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139225278 Original CRISPR TTCCAAGATTTCCCTACACC TGG (reversed) Intergenic
No off target data available for this crispr