ID: 1139229803

View in Genome Browser
Species Human (GRCh38)
Location 16:65272744-65272766
Sequence CTGTACCCCTTTGAGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139229803_1139229811 18 Left 1139229803 16:65272744-65272766 CCCTAGAGCTCAAAGGGGTACAG No data
Right 1139229811 16:65272785-65272807 CTGGTTATAAGACTCAAAGGTGG No data
1139229803_1139229809 15 Left 1139229803 16:65272744-65272766 CCCTAGAGCTCAAAGGGGTACAG No data
Right 1139229809 16:65272782-65272804 CACCTGGTTATAAGACTCAAAGG No data
1139229803_1139229806 -1 Left 1139229803 16:65272744-65272766 CCCTAGAGCTCAAAGGGGTACAG No data
Right 1139229806 16:65272766-65272788 GTGACTTGGCCAAAGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139229803 Original CRISPR CTGTACCCCTTTGAGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr