ID: 1139229896

View in Genome Browser
Species Human (GRCh38)
Location 16:65273538-65273560
Sequence TAGGCCCTGCTTAGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139229893_1139229896 -10 Left 1139229893 16:65273525-65273547 CCTATCACTGTGATAGGCCCTGC No data
Right 1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG No data
1139229891_1139229896 8 Left 1139229891 16:65273507-65273529 CCAATGGTCTGGGTCATTCCTAT No data
Right 1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139229896 Original CRISPR TAGGCCCTGCTTAGGCCAGG TGG Intergenic
No off target data available for this crispr