ID: 1139233653

View in Genome Browser
Species Human (GRCh38)
Location 16:65311676-65311698
Sequence CAGGACGTTCCACCTGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139233653_1139233656 25 Left 1139233653 16:65311676-65311698 CCCTTAACAGGTGGAACGTCCTG No data
Right 1139233656 16:65311724-65311746 TACAGACAATGAAGTTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139233653 Original CRISPR CAGGACGTTCCACCTGTTAA GGG (reversed) Intergenic
No off target data available for this crispr