ID: 1139243581

View in Genome Browser
Species Human (GRCh38)
Location 16:65419246-65419268
Sequence CCTTGGGTCTACAGAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139243581_1139243584 -8 Left 1139243581 16:65419246-65419268 CCTGGGTCTCTGTAGACCCAAGG No data
Right 1139243584 16:65419261-65419283 ACCCAAGGAAAGGAGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139243581 Original CRISPR CCTTGGGTCTACAGAGACCC AGG (reversed) Intergenic
No off target data available for this crispr