ID: 1139243584

View in Genome Browser
Species Human (GRCh38)
Location 16:65419261-65419283
Sequence ACCCAAGGAAAGGAGACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139243580_1139243584 -7 Left 1139243580 16:65419245-65419267 CCCTGGGTCTCTGTAGACCCAAG No data
Right 1139243584 16:65419261-65419283 ACCCAAGGAAAGGAGACTCCAGG No data
1139243581_1139243584 -8 Left 1139243581 16:65419246-65419268 CCTGGGTCTCTGTAGACCCAAGG No data
Right 1139243584 16:65419261-65419283 ACCCAAGGAAAGGAGACTCCAGG No data
1139243576_1139243584 25 Left 1139243576 16:65419213-65419235 CCTTGAAGATGTGATGGAACAAA No data
Right 1139243584 16:65419261-65419283 ACCCAAGGAAAGGAGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139243584 Original CRISPR ACCCAAGGAAAGGAGACTCC AGG Intergenic
No off target data available for this crispr